ID: 1164594850

View in Genome Browser
Species Human (GRCh38)
Location 19:29526118-29526140
Sequence GCTCCCGCAGCCGCCCCCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164594850_1164594855 -3 Left 1164594850 19:29526118-29526140 CCGGCGGGGGCGGCTGCGGGAGC No data
Right 1164594855 19:29526138-29526160 AGCCGAAGGAGGTGGCAATCGGG No data
1164594850_1164594854 -4 Left 1164594850 19:29526118-29526140 CCGGCGGGGGCGGCTGCGGGAGC No data
Right 1164594854 19:29526137-29526159 GAGCCGAAGGAGGTGGCAATCGG No data
1164594850_1164594857 12 Left 1164594850 19:29526118-29526140 CCGGCGGGGGCGGCTGCGGGAGC No data
Right 1164594857 19:29526153-29526175 CAATCGGGAGCAGAACCAGAAGG No data
1164594850_1164594860 23 Left 1164594850 19:29526118-29526140 CCGGCGGGGGCGGCTGCGGGAGC No data
Right 1164594860 19:29526164-29526186 AGAACCAGAAGGAGACAGGGAGG No data
1164594850_1164594859 20 Left 1164594850 19:29526118-29526140 CCGGCGGGGGCGGCTGCGGGAGC No data
Right 1164594859 19:29526161-29526183 AGCAGAACCAGAAGGAGACAGGG No data
1164594850_1164594858 19 Left 1164594850 19:29526118-29526140 CCGGCGGGGGCGGCTGCGGGAGC No data
Right 1164594858 19:29526160-29526182 GAGCAGAACCAGAAGGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164594850 Original CRISPR GCTCCCGCAGCCGCCCCCGC CGG (reversed) Intergenic
No off target data available for this crispr