ID: 1164594856

View in Genome Browser
Species Human (GRCh38)
Location 19:29526140-29526162
Sequence CTCCCGATTGCCACCTCCTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164594856_1164594860 1 Left 1164594856 19:29526140-29526162 CCGAAGGAGGTGGCAATCGGGAG No data
Right 1164594860 19:29526164-29526186 AGAACCAGAAGGAGACAGGGAGG No data
1164594856_1164594859 -2 Left 1164594856 19:29526140-29526162 CCGAAGGAGGTGGCAATCGGGAG No data
Right 1164594859 19:29526161-29526183 AGCAGAACCAGAAGGAGACAGGG No data
1164594856_1164594863 22 Left 1164594856 19:29526140-29526162 CCGAAGGAGGTGGCAATCGGGAG No data
Right 1164594863 19:29526185-29526207 GGCAGAAGCTCGCGGCTCCGTGG No data
1164594856_1164594862 14 Left 1164594856 19:29526140-29526162 CCGAAGGAGGTGGCAATCGGGAG No data
Right 1164594862 19:29526177-29526199 GACAGGGAGGCAGAAGCTCGCGG No data
1164594856_1164594858 -3 Left 1164594856 19:29526140-29526162 CCGAAGGAGGTGGCAATCGGGAG No data
Right 1164594858 19:29526160-29526182 GAGCAGAACCAGAAGGAGACAGG No data
1164594856_1164594857 -10 Left 1164594856 19:29526140-29526162 CCGAAGGAGGTGGCAATCGGGAG No data
Right 1164594857 19:29526153-29526175 CAATCGGGAGCAGAACCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164594856 Original CRISPR CTCCCGATTGCCACCTCCTT CGG (reversed) Intergenic
No off target data available for this crispr