ID: 1164594858

View in Genome Browser
Species Human (GRCh38)
Location 19:29526160-29526182
Sequence GAGCAGAACCAGAAGGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164594850_1164594858 19 Left 1164594850 19:29526118-29526140 CCGGCGGGGGCGGCTGCGGGAGC No data
Right 1164594858 19:29526160-29526182 GAGCAGAACCAGAAGGAGACAGG No data
1164594856_1164594858 -3 Left 1164594856 19:29526140-29526162 CCGAAGGAGGTGGCAATCGGGAG No data
Right 1164594858 19:29526160-29526182 GAGCAGAACCAGAAGGAGACAGG No data
1164594846_1164594858 30 Left 1164594846 19:29526107-29526129 CCGCGGAGGAACCGGCGGGGGCG No data
Right 1164594858 19:29526160-29526182 GAGCAGAACCAGAAGGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164594858 Original CRISPR GAGCAGAACCAGAAGGAGAC AGG Intergenic
No off target data available for this crispr