ID: 1164594899

View in Genome Browser
Species Human (GRCh38)
Location 19:29526301-29526323
Sequence GTGGACGACCGGACAGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 76}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164594882_1164594899 28 Left 1164594882 19:29526250-29526272 CCCCTGCCCGGCCCGCCGGGCAG No data
Right 1164594899 19:29526301-29526323 GTGGACGACCGGACAGAGAGAGG 0: 1
1: 0
2: 0
3: 4
4: 76
1164594887_1164594899 17 Left 1164594887 19:29526261-29526283 CCCGCCGGGCAGAGACTGAACCG No data
Right 1164594899 19:29526301-29526323 GTGGACGACCGGACAGAGAGAGG 0: 1
1: 0
2: 0
3: 4
4: 76
1164594888_1164594899 16 Left 1164594888 19:29526262-29526284 CCGCCGGGCAGAGACTGAACCGC No data
Right 1164594899 19:29526301-29526323 GTGGACGACCGGACAGAGAGAGG 0: 1
1: 0
2: 0
3: 4
4: 76
1164594890_1164594899 13 Left 1164594890 19:29526265-29526287 CCGGGCAGAGACTGAACCGCGGA No data
Right 1164594899 19:29526301-29526323 GTGGACGACCGGACAGAGAGAGG 0: 1
1: 0
2: 0
3: 4
4: 76
1164594885_1164594899 22 Left 1164594885 19:29526256-29526278 CCCGGCCCGCCGGGCAGAGACTG No data
Right 1164594899 19:29526301-29526323 GTGGACGACCGGACAGAGAGAGG 0: 1
1: 0
2: 0
3: 4
4: 76
1164594884_1164594899 26 Left 1164594884 19:29526252-29526274 CCTGCCCGGCCCGCCGGGCAGAG No data
Right 1164594899 19:29526301-29526323 GTGGACGACCGGACAGAGAGAGG 0: 1
1: 0
2: 0
3: 4
4: 76
1164594891_1164594899 -3 Left 1164594891 19:29526281-29526303 CCGCGGATCCCCACCGTCCTGTG 0: 1
1: 0
2: 0
3: 6
4: 107
Right 1164594899 19:29526301-29526323 GTGGACGACCGGACAGAGAGAGG 0: 1
1: 0
2: 0
3: 4
4: 76
1164594883_1164594899 27 Left 1164594883 19:29526251-29526273 CCCTGCCCGGCCCGCCGGGCAGA No data
Right 1164594899 19:29526301-29526323 GTGGACGACCGGACAGAGAGAGG 0: 1
1: 0
2: 0
3: 4
4: 76
1164594886_1164594899 21 Left 1164594886 19:29526257-29526279 CCGGCCCGCCGGGCAGAGACTGA No data
Right 1164594899 19:29526301-29526323 GTGGACGACCGGACAGAGAGAGG 0: 1
1: 0
2: 0
3: 4
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164594899 Original CRISPR GTGGACGACCGGACAGAGAG AGG Intergenic
901443456 1:9293105-9293127 GTGGGCGACCGGCCCGGGAGGGG + Intronic
905300943 1:36985853-36985875 GTGGGAGATCGGACAGAGAAGGG - Intronic
907279772 1:53339913-53339935 GTGGAGGAGAGGACAGAGTGGGG - Intergenic
913436140 1:118849716-118849738 GTGGAGGACCTGGCTGAGAGAGG - Intergenic
915367838 1:155325368-155325390 GTGGAGGGCCGGGCAGAGGGTGG - Exonic
916055685 1:161067828-161067850 GTGGAAGGAAGGACAGAGAGAGG - Intronic
923126642 1:231039830-231039852 GGGGACTTCCGGACAGAGCGCGG + Intronic
1067005224 10:42654535-42654557 TTGGACTACGGGACAGGGAGTGG - Intergenic
1067799480 10:49349277-49349299 GTGGAAGACCGGAAGGAGAGAGG + Intergenic
1069950625 10:72015865-72015887 GTGGAACACCCCACAGAGAGTGG + Intergenic
1072526014 10:96272350-96272372 GTGGTGGACAGGACAGAAAGAGG - Intergenic
1076472862 10:130731501-130731523 GGTGATGACCGGAAAGAGAGTGG + Intergenic
1078935028 11:15942337-15942359 GTGGAGGGCCGCACGGAGAGGGG + Intergenic
1084960335 11:72713084-72713106 GAGGACTACCAGACAGAGAGTGG - Intronic
1091204218 11:133808511-133808533 GTGGACGAGAGGAAAGGGAGAGG - Intergenic
1104654535 12:130564051-130564073 GAGGAAGAGGGGACAGAGAGAGG - Intronic
1109178936 13:59189827-59189849 GTGGACTAGAGGAGAGAGAGAGG - Intergenic
1113892443 13:113743506-113743528 GGGGAGGACGGGACGGAGAGAGG + Intergenic
1118166589 14:63342285-63342307 GTGAAAGAGGGGACAGAGAGGGG - Intergenic
1124136172 15:27038107-27038129 GTGGCCAACCGGACTGAGATGGG - Intronic
1127818273 15:62632010-62632032 TTGGACCACCGGTAAGAGAGTGG + Intronic
1127923595 15:63515850-63515872 GTGGACAGCAGGACTGAGAGTGG - Intronic
1130017725 15:80200594-80200616 GTGAACGAAAGGACAGAAAGGGG - Intergenic
1131362632 15:91806764-91806786 CTGGGCGAGAGGACAGAGAGTGG + Intergenic
1135509238 16:23068284-23068306 GGGGACGACGAGGCAGAGAGAGG - Exonic
1146941272 17:36845978-36846000 GTGGCCGTGGGGACAGAGAGGGG + Intergenic
1151338408 17:73454599-73454621 GTGGCTGTCCGGAAAGAGAGGGG + Intronic
1151397788 17:73835855-73835877 GTGGGGGACTGGACAGAGAAGGG + Intergenic
1151496303 17:74460231-74460253 GTGGATGAAAGGAGAGAGAGAGG - Intergenic
1153227020 18:2907025-2907047 GTGGACGGCCAGACCGGGAGCGG + Exonic
1156902001 18:42310826-42310848 GTGGAAGACTGGAGGGAGAGAGG - Intergenic
1158023507 18:52870011-52870033 TTGGAGGAGCGGACAGAAAGGGG - Intronic
1162956853 19:14103510-14103532 TTGGAAGACCAGACACAGAGGGG + Intronic
1164594899 19:29526301-29526323 GTGGACGACCGGACAGAGAGAGG + Intergenic
1167395200 19:49223870-49223892 GTGGAAGAGCAGAAAGAGAGGGG + Intergenic
1168050146 19:53823898-53823920 GTGGGAGAGAGGACAGAGAGAGG - Exonic
942401775 2:175610418-175610440 GTGGACGTTCTGACAGGGAGTGG + Intergenic
946064247 2:216973137-216973159 GTGCATGACAGGCCAGAGAGTGG + Intergenic
946506942 2:220311961-220311983 GTGGAGGACTGGACAGAGGACGG - Intergenic
948813864 2:240499800-240499822 TTGGACGACGGGACACAAAGGGG + Intronic
1171364299 20:24613357-24613379 GGAGACGGCAGGACAGAGAGCGG - Intronic
1172774026 20:37396976-37396998 GTGGCCGAAGAGACAGAGAGTGG - Intronic
1174165807 20:48582795-48582817 GTGGAAGCCTGGAGAGAGAGAGG - Intergenic
1175780158 20:61677010-61677032 GCTGAGGACCAGACAGAGAGAGG + Intronic
1177894722 21:26845339-26845361 GTGCGCTACCGGACGGAGAGGGG - Exonic
1179277728 21:39907426-39907448 CTGGAGGAGCGGACAGACAGGGG + Intronic
1179654547 21:42837330-42837352 GTGGACAGTGGGACAGAGAGAGG - Intergenic
1182960844 22:34473644-34473666 GTGGAAGACTGGAAAGAGATGGG - Intergenic
1184611435 22:45606524-45606546 GGGGAGGACTGGACAGAGTGGGG - Intergenic
950873462 3:16249251-16249273 TGGGAAGACCGGACAGAGAGAGG + Intergenic
953261810 3:41346553-41346575 GAGGAGGAACGGACAGAGGGAGG + Intronic
962251635 3:133839560-133839582 GACGACGTCAGGACAGAGAGGGG - Exonic
974841313 4:67302706-67302728 GGGGAAGACAGGAGAGAGAGAGG + Intergenic
976690063 4:87859289-87859311 GTGGACGAGAGGACAGATGGGGG - Intergenic
979431383 4:120636352-120636374 CTGGATGCCAGGACAGAGAGAGG + Intergenic
986754901 5:10826462-10826484 GTGGAAGACAGGAGAGAGAAAGG + Intergenic
997335501 5:133106268-133106290 ATGGAGGCCAGGACAGAGAGTGG + Exonic
997932439 5:138083628-138083650 GAGGATGGCAGGACAGAGAGTGG + Intergenic
1002576053 5:180174708-180174730 GTGGACCACAGCCCAGAGAGGGG - Intronic
1002801163 6:522565-522587 GTGGACGACATGACAGTGTGTGG + Intronic
1005811393 6:29518899-29518921 CTGGAGGACAGGTCAGAGAGAGG - Intergenic
1006109217 6:31734749-31734771 GTGGAGGGCCCTACAGAGAGGGG + Intronic
1012500253 6:99880745-99880767 GTGGACGGCAAGACGGAGAGTGG + Intergenic
1013993589 6:116281126-116281148 GAGGACGAAAGCACAGAGAGAGG + Intronic
1019316032 7:387319-387341 GTGCAGGACCCAACAGAGAGGGG - Intergenic
1019726151 7:2603695-2603717 GTGAACGACCCGCCAGAGTGTGG - Intronic
1022769128 7:33450026-33450048 GGGGCCGACCTGACAGGGAGTGG - Intronic
1026457843 7:70588410-70588432 GGGGACGACGGGGAAGAGAGAGG + Intronic
1029540749 7:101180576-101180598 GGGGACCCCCGGACAGAGAACGG - Intergenic
1039953111 8:42187638-42187660 GGGGAGGACGGGGCAGAGAGGGG - Intronic
1040410397 8:47148484-47148506 GGGGACTACCAGACAGAGAACGG + Intergenic
1041943820 8:63419719-63419741 GTGGATGACTGGACAGTGAGAGG + Intergenic
1049579087 8:143402944-143402966 GTGCAGGCCAGGACAGAGAGGGG - Intergenic
1059154835 9:111980528-111980550 GGGGATGACAGGACAGATAGGGG - Intergenic
1060394046 9:123303289-123303311 GAGGATGACAGGACAGGGAGAGG - Intergenic
1061911836 9:133729135-133729157 ATGGAGGGCTGGACAGAGAGAGG + Intronic
1186458241 X:9727719-9727741 GTGGAAGACACAACAGAGAGTGG + Intronic
1187941946 X:24391191-24391213 ATGGAGGACAGGACAGAGAAGGG + Intergenic
1190287684 X:48971716-48971738 GAGGACGCCCCGAGAGAGAGGGG - Intergenic
1190322391 X:49186655-49186677 GTGGCCAACTGGACTGAGAGGGG + Intergenic
1199996202 X:153028281-153028303 GGGGACGATGGGAGAGAGAGGGG + Intergenic