ID: 1164599098

View in Genome Browser
Species Human (GRCh38)
Location 19:29549054-29549076
Sequence AGTCCTGGGGTTGCTGATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 181}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164599084_1164599098 17 Left 1164599084 19:29549014-29549036 CCCCCACCCACCCCAGTGTTCTG 0: 1
1: 0
2: 6
3: 54
4: 528
Right 1164599098 19:29549054-29549076 AGTCCTGGGGTTGCTGATTCTGG 0: 1
1: 0
2: 1
3: 21
4: 181
1164599087_1164599098 14 Left 1164599087 19:29549017-29549039 CCACCCACCCCAGTGTTCTGTAG 0: 1
1: 0
2: 3
3: 32
4: 334
Right 1164599098 19:29549054-29549076 AGTCCTGGGGTTGCTGATTCTGG 0: 1
1: 0
2: 1
3: 21
4: 181
1164599086_1164599098 15 Left 1164599086 19:29549016-29549038 CCCACCCACCCCAGTGTTCTGTA 0: 1
1: 0
2: 7
3: 19
4: 203
Right 1164599098 19:29549054-29549076 AGTCCTGGGGTTGCTGATTCTGG 0: 1
1: 0
2: 1
3: 21
4: 181
1164599085_1164599098 16 Left 1164599085 19:29549015-29549037 CCCCACCCACCCCAGTGTTCTGT 0: 1
1: 0
2: 3
3: 48
4: 559
Right 1164599098 19:29549054-29549076 AGTCCTGGGGTTGCTGATTCTGG 0: 1
1: 0
2: 1
3: 21
4: 181
1164599088_1164599098 11 Left 1164599088 19:29549020-29549042 CCCACCCCAGTGTTCTGTAGCTT 0: 1
1: 0
2: 0
3: 24
4: 259
Right 1164599098 19:29549054-29549076 AGTCCTGGGGTTGCTGATTCTGG 0: 1
1: 0
2: 1
3: 21
4: 181
1164599091_1164599098 7 Left 1164599091 19:29549024-29549046 CCCCAGTGTTCTGTAGCTTGGTG 0: 1
1: 0
2: 1
3: 11
4: 153
Right 1164599098 19:29549054-29549076 AGTCCTGGGGTTGCTGATTCTGG 0: 1
1: 0
2: 1
3: 21
4: 181
1164599092_1164599098 6 Left 1164599092 19:29549025-29549047 CCCAGTGTTCTGTAGCTTGGTGG 0: 1
1: 0
2: 1
3: 12
4: 143
Right 1164599098 19:29549054-29549076 AGTCCTGGGGTTGCTGATTCTGG 0: 1
1: 0
2: 1
3: 21
4: 181
1164599089_1164599098 10 Left 1164599089 19:29549021-29549043 CCACCCCAGTGTTCTGTAGCTTG 0: 1
1: 0
2: 0
3: 7
4: 157
Right 1164599098 19:29549054-29549076 AGTCCTGGGGTTGCTGATTCTGG 0: 1
1: 0
2: 1
3: 21
4: 181
1164599094_1164599098 5 Left 1164599094 19:29549026-29549048 CCAGTGTTCTGTAGCTTGGTGGA 0: 1
1: 0
2: 0
3: 11
4: 162
Right 1164599098 19:29549054-29549076 AGTCCTGGGGTTGCTGATTCTGG 0: 1
1: 0
2: 1
3: 21
4: 181
1164599083_1164599098 21 Left 1164599083 19:29549010-29549032 CCGGCCCCCACCCACCCCAGTGT 0: 1
1: 1
2: 12
3: 125
4: 1069
Right 1164599098 19:29549054-29549076 AGTCCTGGGGTTGCTGATTCTGG 0: 1
1: 0
2: 1
3: 21
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164599098 Original CRISPR AGTCCTGGGGTTGCTGATTC TGG Intronic
903126488 1:21251720-21251742 CCTCCTGGGGATGCTGATCCAGG - Intronic
903676752 1:25069154-25069176 AATCCAGGAGTGGCTGATTCTGG + Intergenic
903745072 1:25581408-25581430 AGACCAGGAGTTGCTGAATCCGG + Intergenic
905764950 1:40592578-40592600 AGTCCATAGGTTGCTGGTTCTGG + Intergenic
907153502 1:52310618-52310640 AAACCTGGGCTTTCTGATTCTGG + Intronic
910064345 1:83135246-83135268 AGTCCTGGGGAGGCTGAGGCAGG + Intergenic
910672442 1:89786728-89786750 AGTCCTGGGCTGTCTGCTTCTGG - Intronic
914435300 1:147654168-147654190 AGTCCTGGGGTTGGGGAGCCTGG - Intronic
914461500 1:147889972-147889994 AACCCTCGGGTTGGTGATTCTGG + Intergenic
915541804 1:156572223-156572245 AGTTCTGGGGTTCCGGAGTCGGG - Intronic
915600573 1:156920710-156920732 AGTCTGGGGGTGGCTGAATCAGG - Exonic
921920060 1:220658405-220658427 ACTCCCAGGGTTTCTGATTCAGG + Intronic
923188986 1:231601960-231601982 GGTCCTGGGATTGCAGGTTCTGG + Intronic
1064285256 10:13985842-13985864 AGCCCTGGCGATGCTGATTTAGG + Intronic
1069962768 10:72088091-72088113 AGACCCGGGGTTGCGGGTTCGGG - Intronic
1070505331 10:77107864-77107886 AGTCCTTGGGTGGCAGATCCAGG - Intronic
1070605818 10:77897996-77898018 AGTCCTGTGATTGCCCATTCAGG + Intronic
1070831868 10:79422695-79422717 AGCCCTGGGCATGCTGACTCAGG + Intronic
1071751026 10:88476006-88476028 AATCCAGGGGTTTATGATTCAGG + Intronic
1073892869 10:108121119-108121141 AGTCCAGGACTTGTTGATTCAGG - Intergenic
1074736371 10:116438353-116438375 AGCCCTGAGGTTACAGATTCAGG - Intronic
1076685792 10:132197940-132197962 AGTATTGGGGCTGCTGCTTCTGG + Intronic
1077283763 11:1756929-1756951 GGTCCCGGGGTTGCTGATGGTGG - Intronic
1078094114 11:8285992-8286014 AGGCCTGAGGGTGCTGCTTCTGG - Intergenic
1078723070 11:13901818-13901840 AGTCCTGGACATGCTGGTTCTGG + Intergenic
1079530494 11:21446915-21446937 AATTCTGGGGTTTCTGACTCTGG - Intronic
1081429167 11:42956979-42957001 AGTTCTGGGGAGGCTGACTCGGG - Intergenic
1081908472 11:46684149-46684171 AGGCATGGGGTGGCTGATGCTGG + Intronic
1083094336 11:60233942-60233964 AATCCTGGGAGTGCTGATTGGGG - Intronic
1083115415 11:60454748-60454770 AGTTCTGGGGAGGCTGATTGTGG - Intronic
1084231090 11:67753863-67753885 TGTCCTGTGGTTGTTGATCCTGG - Intergenic
1085713380 11:78850974-78850996 AGCCCAGGGGATCCTGATTCTGG - Intronic
1087032700 11:93721876-93721898 ACTGCTGGGGTTGGTGATTTGGG + Intronic
1088041732 11:105393272-105393294 TGTGCTGGGGTTTCTGATTGAGG - Intergenic
1090920437 11:131201787-131201809 AGTGCTGGGGATGCTGAACCTGG - Intergenic
1091330913 11:134730245-134730267 AGTCCTGGGGCTGCAAATCCAGG - Intergenic
1098025016 12:66192050-66192072 ACTCCTAGAGCTGCTGATTCAGG + Intronic
1098307769 12:69118593-69118615 TATCCTGGGCTTGCTCATTCGGG - Intergenic
1098480805 12:70958249-70958271 AGTTGTGGGTTTGCTGTTTCTGG - Intergenic
1098961452 12:76743911-76743933 AGTCTTGGAGATGCTGATTCAGG - Intergenic
1101098134 12:101364936-101364958 TTTCCTGAGGTTGCTGATCCTGG + Intronic
1104067315 12:125316658-125316680 AGACCTGGGGCAGCTCATTCCGG + Intronic
1105776070 13:23661558-23661580 AGTAATGGGATTGCTGAGTCAGG + Intronic
1105897275 13:24726958-24726980 AGCCCTGGAGGTTCTGATTCAGG - Intergenic
1106245954 13:27950331-27950353 AGTAATGGGATTGCTGATTCAGG + Intergenic
1106383393 13:29262092-29262114 AGTCCTGGGCTGGCTGATGCTGG + Intronic
1108333976 13:49419907-49419929 AGTACTGGGATTGCTGATCTTGG - Intronic
1112342612 13:98565249-98565271 TGCCCTGGAGTTTCTGATTCTGG - Intronic
1113016789 13:105837061-105837083 TGTTCTGGGGTTGTTAATTCAGG - Intergenic
1113642735 13:111969783-111969805 AGTCCTGGGGTTGCTCACGCAGG + Intergenic
1114080603 14:19199432-19199454 AGGCCCGGGGATGCTGCTTCTGG + Intergenic
1114814618 14:25942802-25942824 ATTGCTGGAGTTGCTGGTTCAGG + Intergenic
1116300542 14:43175814-43175836 TATCCTGGGGCTGCTGTTTCTGG - Intergenic
1117478296 14:56118741-56118763 AGTCCTGGGGTCCCTGGTCCCGG + Intronic
1117549585 14:56820740-56820762 TGTTCTGGAGCTGCTGATTCTGG + Intergenic
1119268129 14:73277159-73277181 AGGCCTGGGGCTGCTGAGCCCGG + Exonic
1119465567 14:74855432-74855454 AGTCCTAGGGTTGCAGAATCAGG - Intronic
1120292217 14:82589979-82590001 ACGGCTGGGGTTGCTGATCCGGG + Intergenic
1121513985 14:94536766-94536788 AGCCCATGGGTTGCTGACTCTGG - Intergenic
1121619665 14:95337353-95337375 ATTCATGGGGTTGGTGCTTCTGG + Intergenic
1122886835 14:104713965-104713987 ATTCCTGGGGTGGCTGCCTCAGG + Intronic
1123628129 15:22241576-22241598 AGTGCTGGGGTTGCTGGTGCTGG + Intergenic
1126852647 15:52806331-52806353 TGTCCTGGGGTCGCTGACCCTGG - Intergenic
1127281445 15:57496943-57496965 AGCTCTGTGGTTGCTGAGTCCGG + Intronic
1128649604 15:69400934-69400956 ACTCCTGGCGTTTCTGGTTCAGG - Intronic
1130801446 15:87267669-87267691 ACTCCTGGGGGTGCAGAGTCTGG - Intergenic
1131032485 15:89197784-89197806 AGTCCTGGGGGAGCAAATTCCGG - Exonic
1131316425 15:91342207-91342229 AGTCCTGGGGCTGCTGAGGGAGG - Intergenic
1131410671 15:92205185-92205207 AGTCCTGAGGTTCCTGTTGCAGG - Intergenic
1133962116 16:10503564-10503586 TGTCCTGTGGTTGATGAATCGGG + Intergenic
1134680985 16:16125360-16125382 ATACCTGGGGTTGCTAATTTCGG + Intronic
1135028920 16:19021672-19021694 ATTCCTGGTGTTGCTGAATTTGG + Exonic
1138228934 16:55324011-55324033 AGTCCTGGGGAGGCTGAGGCGGG + Exonic
1141921241 16:87136962-87136984 AGGCCTGGGATTGATGATTGAGG - Intronic
1141975814 16:87515758-87515780 AACCCTGGGGTTGCTGGTGCTGG - Intergenic
1142718838 17:1763002-1763024 ATTCTTGGGGCTGCTGCTTCTGG + Intronic
1144777155 17:17790753-17790775 GGTCCTGGGTTTGCACATTCTGG + Intronic
1145359711 17:22202240-22202262 AGTCCTGGGGAGGCTGAGGCAGG - Intergenic
1145917585 17:28584782-28584804 AGTCCTGGGATTATTGATTCAGG - Intronic
1146053075 17:29567708-29567730 AGGCTTGGGGCTGCTGTTTCTGG - Intronic
1150305289 17:64079531-64079553 ACCCCTGGGGATTCTGATTCAGG - Intronic
1151264411 17:72943179-72943201 AGCCCTGGGGTTGCTGATCCGGG + Intronic
1151952869 17:77364786-77364808 AGTCCTGGGGCTGCTGGCTGAGG + Intronic
1152410002 17:80118361-80118383 AGTCCTGGGGCTGCTCAGGCTGG + Intergenic
1153237873 18:3005759-3005781 AGTGCTGGGATTGCTGAGTTGGG - Intronic
1155177642 18:23314792-23314814 GGTCCTGGGGTTTGTTATTCGGG - Intronic
1156006766 18:32451484-32451506 AGTCCTGAGGTTACTGACTTGGG - Intronic
1156466860 18:37353337-37353359 ACCCCTGGGATTGCTGAATCTGG - Intronic
1159198552 18:65150794-65150816 AGTCCAGGGCTTGCTTCTTCAGG - Intergenic
1160690353 19:458519-458541 GGTCCTGGGGAGGCGGATTCGGG + Intronic
1162705622 19:12552802-12552824 ATTCATGGGGTCGCTGAGTCAGG - Intronic
1163493166 19:17629179-17629201 AGTCCTGGGGATGCTGAATGGGG + Intronic
1164595563 19:29528993-29529015 GGTCATGGGGTTGCTAACTCTGG + Intronic
1164599098 19:29549054-29549076 AGTCCTGGGGTTGCTGATTCTGG + Intronic
1165176606 19:33935002-33935024 AGAGCTGGGTTTTCTGATTCAGG - Intergenic
1165454622 19:35903533-35903555 AGGCTGGGGGTCGCTGATTCTGG - Intronic
1165717748 19:38057517-38057539 ACTCCTGGTGTTGCTCATTGAGG + Intronic
1165780476 19:38430775-38430797 AGTCCTGGGGGTGCTGAGGCAGG + Intergenic
1167702866 19:51060669-51060691 AGCCCTGGGGTTGTGGTTTCTGG + Intronic
925132368 2:1503032-1503054 CGTCCTGGGGTGGCCGAGTCGGG + Intronic
926066243 2:9842921-9842943 AATCCTGGGGAGGCTGAGTCGGG - Intergenic
927963684 2:27256566-27256588 AGTGGTGGGGGTGCTGCTTCTGG - Intronic
931160208 2:59681266-59681288 AATCCTGGGGTTGATAATTTTGG + Intergenic
931656708 2:64516028-64516050 TCTACTGGGGTTGCTAATTCTGG - Intergenic
932493845 2:72137073-72137095 GGTCCTGGGCTGGCTGTTTCTGG - Intronic
934501312 2:94862098-94862120 AGTCCTGGCTTTGCTGTTCCCGG - Intergenic
938663352 2:133509479-133509501 AGTCATGGGGGTGCTGAATATGG - Intronic
939798206 2:146674532-146674554 ATTCCTGAGGCTGCTGACTCAGG - Intergenic
943041759 2:182812671-182812693 ACTCCTAGAGTTTCTGATTCGGG - Intergenic
945994036 2:216420970-216420992 ACTACTGGAGTTTCTGATTCTGG + Intronic
948321784 2:237075828-237075850 AGTCCTGGGCTTTCTGCTTAGGG - Intergenic
1169300476 20:4437852-4437874 GGTACTGGGACTGCTGATTCAGG - Intergenic
1169686286 20:8276771-8276793 AGTACTGGGCTTGGTGATTCAGG - Intronic
1169779627 20:9295020-9295042 AGTCCTGGGGTTCCAGAGTGGGG - Intronic
1170681321 20:18528184-18528206 ATTCCCGGGGTTTCCGATTCAGG - Intronic
1172055896 20:32154054-32154076 AGTCTTGGGGTGGCAGATGCTGG - Intronic
1172694508 20:36812907-36812929 AGGCCTGGGGTGGGTGTTTCTGG - Intronic
1173458773 20:43225050-43225072 AGTCCTGGGGTTGGCAATTCTGG + Intergenic
1177048401 21:16200758-16200780 AGTACTGGGATTGCTGGGTCAGG + Intergenic
1179482272 21:41685812-41685834 AGTCCTGGCGGTGCTGCTGCTGG + Intergenic
1180500173 22:15923253-15923275 AGGCCCGGGGATGCTGCTTCTGG - Intergenic
1180953244 22:19730207-19730229 AGTCCCAGGCTAGCTGATTCAGG + Intergenic
1183103236 22:35596828-35596850 AGCCCTGGGTTTGCTGTTCCTGG - Intergenic
1184166896 22:42734882-42734904 ATCCCTGGGGCTTCTGATTCAGG + Intergenic
949578374 3:5361061-5361083 ACCCCTGGAGTTTCTGATTCAGG - Intergenic
950400023 3:12762785-12762807 ACTCCTGGAGTTTCTGATTCAGG - Intronic
952517540 3:34121042-34121064 TGTCCTGGGGTTGCTCTTACCGG + Intergenic
954710070 3:52501276-52501298 AGTCCTGGGTTATCTGATCCGGG - Exonic
955747396 3:62153875-62153897 AGTGCTGGGGGTGCTGGTGCAGG + Intronic
955932203 3:64068285-64068307 AGGCCTGGGCTAGCTGAGTCAGG - Intergenic
957047640 3:75388755-75388777 TGTCCTGTGGTTGTTGATCCTGG - Intergenic
958078231 3:88711974-88711996 AGTGGTGGTGTTGGTGATTCAGG - Intergenic
959087183 3:101863896-101863918 AATCCTGGAGATTCTGATTCAGG - Intergenic
959914516 3:111801288-111801310 AGTCCTGGGGTTCATGAAGCAGG + Intronic
961879713 3:130052879-130052901 TGTCCTGTGGTTGTTGATCCTGG - Intergenic
962163525 3:133024566-133024588 AGTGCTGGAGTTGCTTACTCTGG - Intergenic
967518163 3:190396139-190396161 AATCCTGGGATTTCTTATTCTGG - Intronic
967844380 3:194032513-194032535 AGTCCTGGGGGTGCGGTGTCTGG - Intergenic
968991919 4:3919988-3920010 TGTCCTGTGGTTGTTGATCCTGG - Intergenic
969823418 4:9737691-9737713 TGTCCTGTGGTTGCTGATCCTGG + Intergenic
969877202 4:10144595-10144617 AGATCAGGGGTTGCTGATACAGG - Intergenic
970642281 4:18080319-18080341 AGTCCTGGGAGTGTTGATGCTGG + Intergenic
974226885 4:59057895-59057917 AGTCCAGAGGTTGCTAAATCTGG + Intergenic
975540516 4:75505307-75505329 AGTGCTTGGGGTGCGGATTCTGG - Intronic
975697349 4:77026437-77026459 AGTCCTGGAGAGGCTGATTCAGG - Intronic
977153657 4:93545885-93545907 AGTCCTTGTGTTGCTAATCCTGG - Intronic
984679232 4:182587673-182587695 AGTTCTGGGATTACTGATACGGG + Intronic
985956523 5:3269847-3269869 GGCCCTGGCGTTGCTGTTTCAGG + Intergenic
987035056 5:14011444-14011466 AGGGCTGGGATTGCTGTTTCTGG - Intergenic
989367263 5:40670664-40670686 ATTCCCGGGTTTGCTGATTCAGG + Intergenic
989995289 5:50822055-50822077 AGTTATGGGGCTCCTGATTCAGG - Intronic
992894522 5:81234778-81234800 AGTCCTGGGGTTTCAGACACAGG + Intronic
994890029 5:105621767-105621789 AGTCCTGGGTCTTCTGATTTTGG - Intergenic
997511842 5:134459638-134459660 AGGCCTGGGGTTGAGGATACTGG - Intergenic
999513476 5:152277030-152277052 TGTCTGGGGGTTGCTGATTCAGG + Intergenic
999777738 5:154824260-154824282 GGTCAAAGGGTTGCTGATTCTGG - Intronic
1005008534 6:21313701-21313723 ACTCCCAGGGTTTCTGATTCAGG + Intergenic
1006096706 6:31660756-31660778 AGTCCTGGTGCAGCTGCTTCCGG - Exonic
1006360259 6:33583652-33583674 GGTCCTGGGGTGGCTGTTACAGG + Intergenic
1010538053 6:77055418-77055440 AGTTTTAGGGATGCTGATTCTGG + Intergenic
1010768247 6:79800279-79800301 AGTCCTGGGGTTATTGATTAAGG - Intergenic
1014267109 6:119292043-119292065 AGTACTGTGGCTCCTGATTCAGG + Intronic
1016581729 6:145635651-145635673 AGTACTGGTGTTGCTGCTTTGGG + Intronic
1017790470 6:157793682-157793704 GGTGCTGGGGTTGCTGAGGCAGG - Intronic
1017949804 6:159127218-159127240 AGACCTGGTGTCGCTGATGCAGG - Intergenic
1019413831 7:918560-918582 AGTGCTGGGGTTGCAGGTCCGGG + Intronic
1020314736 7:6897558-6897580 TGTCCTGTGGTTGTTGATCCTGG - Intergenic
1022648202 7:32251249-32251271 AGTCCTGGGCTGCCGGATTCAGG - Intronic
1023142012 7:37111039-37111061 GGTCCTGGGGCAGCTGATGCTGG - Intronic
1026765727 7:73158368-73158390 AGTCCTGGGATTACTGCTCCTGG + Intergenic
1027042201 7:74968065-74968087 AGTCCTGGGATTACTGCTCCTGG + Intronic
1027081441 7:75234293-75234315 AGTCCTGGGATTACTGCTCCTGG - Intergenic
1028317299 7:89419438-89419460 AGTCCTGGGGTTCCTGTCTTAGG - Intergenic
1029390028 7:100268882-100268904 AGTCCTGGGATTACTGCTCCTGG - Intronic
1030617794 7:111756564-111756586 TGTCCTGGGGTTGCTCGTCCCGG - Intronic
1031016782 7:116584248-116584270 AGTACTAGTGTTGCTGATACTGG + Intergenic
1034891669 7:154845017-154845039 AGTCCTGGTTTTTCTAATTCAGG - Intronic
1034998983 7:155596370-155596392 AGGCCTGGGGATGCTGATACAGG - Intergenic
1037882989 8:22581893-22581915 AGTCCTGGGGATGCAGCCTCGGG - Intronic
1039394195 8:37209138-37209160 AGCCCTGAGGCTTCTGATTCAGG - Intergenic
1039421878 8:37450293-37450315 AGTCCTGGGGCTGCTGACTGTGG + Intergenic
1042370956 8:67990302-67990324 AGTCCTGGTGTTGCTGGATATGG + Intronic
1043323352 8:79018105-79018127 AGTCCTAGGATCCCTGATTCCGG - Intergenic
1043822019 8:84878302-84878324 AGTGCTGTGGTAGCTGAGTCAGG - Intronic
1045471590 8:102517541-102517563 AGTCCTGGGGTTGCTGTTGTTGG - Intergenic
1046899823 8:119511992-119512014 AGGACTGGGGTTGCTGGTTGAGG + Intergenic
1047501242 8:125443408-125443430 AGGCCTGAGGGTGCTGAGTCAGG - Intergenic
1047807280 8:128373576-128373598 GGTCCTGGTGTTGCTGGTGCAGG + Intergenic
1048180067 8:132186150-132186172 TGTCCTGGGGTGCTTGATTCTGG - Exonic
1049859550 8:144889411-144889433 AGACTGGGGGTTGCTGAATCAGG - Intronic
1053140533 9:35679977-35679999 AGTCCTCGGGCTGCTGAGCCAGG + Exonic
1056775790 9:89511772-89511794 AGACCTGGGTTGGCTGATTTGGG + Intergenic
1057776854 9:98018370-98018392 AGTCCTGGTGGTGGTGATACAGG - Intergenic
1058324019 9:103672581-103672603 ACTCCTGGAGTTTCTGATTCAGG + Intergenic
1061388741 9:130305642-130305664 AGGGCTGTGGTTGCTGTTTCTGG + Intronic
1186466838 X:9789981-9790003 AGCCCTGGGGTGGGTGAGTCAGG - Intronic
1195913318 X:109911513-109911535 GGGCCTGGAGTTGGTGATTCAGG + Intergenic
1196609429 X:117694998-117695020 AGTGGTGGTGTTGGTGATTCAGG - Intergenic
1196699003 X:118645782-118645804 AGTGCTGGGATTACAGATTCAGG - Intronic
1199156149 X:144551214-144551236 ACACCTGGGGTCCCTGATTCAGG + Intergenic
1199187478 X:144932764-144932786 TGTCCTGGGCTTGCTGTTACTGG + Intergenic
1200792577 Y:7312742-7312764 AGAACTGGGGTTGCTGCTCCTGG - Intergenic
1200815741 Y:7530402-7530424 AGTCCTAGGGTTGCAAAGTCAGG - Intergenic
1200930659 Y:8694111-8694133 AGCCCAGGGTTTTCTGATTCTGG - Intergenic