ID: 1164602136

View in Genome Browser
Species Human (GRCh38)
Location 19:29569276-29569298
Sequence TGCCCAGTGTCACCCAAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164602136_1164602140 23 Left 1164602136 19:29569276-29569298 CCCACTTTGGGTGACACTGGGCA No data
Right 1164602140 19:29569322-29569344 GATGCAACTCCTGCTTTTCCTGG No data
1164602136_1164602141 24 Left 1164602136 19:29569276-29569298 CCCACTTTGGGTGACACTGGGCA No data
Right 1164602141 19:29569323-29569345 ATGCAACTCCTGCTTTTCCTGGG No data
1164602136_1164602143 26 Left 1164602136 19:29569276-29569298 CCCACTTTGGGTGACACTGGGCA No data
Right 1164602143 19:29569325-29569347 GCAACTCCTGCTTTTCCTGGGGG No data
1164602136_1164602142 25 Left 1164602136 19:29569276-29569298 CCCACTTTGGGTGACACTGGGCA No data
Right 1164602142 19:29569324-29569346 TGCAACTCCTGCTTTTCCTGGGG No data
1164602136_1164602138 1 Left 1164602136 19:29569276-29569298 CCCACTTTGGGTGACACTGGGCA No data
Right 1164602138 19:29569300-29569322 TCATTTTGCCTGCATTTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164602136 Original CRISPR TGCCCAGTGTCACCCAAAGT GGG (reversed) Intergenic
No off target data available for this crispr