ID: 1164602139

View in Genome Browser
Species Human (GRCh38)
Location 19:29569308-29569330
Sequence AGTTGCATCCTCTGAAATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164602139_1164602143 -6 Left 1164602139 19:29569308-29569330 CCTGCATTTCAGAGGATGCAACT No data
Right 1164602143 19:29569325-29569347 GCAACTCCTGCTTTTCCTGGGGG No data
1164602139_1164602142 -7 Left 1164602139 19:29569308-29569330 CCTGCATTTCAGAGGATGCAACT No data
Right 1164602142 19:29569324-29569346 TGCAACTCCTGCTTTTCCTGGGG No data
1164602139_1164602148 9 Left 1164602139 19:29569308-29569330 CCTGCATTTCAGAGGATGCAACT No data
Right 1164602148 19:29569340-29569362 CCTGGGGGACAGGTGGCCAGAGG No data
1164602139_1164602146 2 Left 1164602139 19:29569308-29569330 CCTGCATTTCAGAGGATGCAACT No data
Right 1164602146 19:29569333-29569355 TGCTTTTCCTGGGGGACAGGTGG No data
1164602139_1164602144 -1 Left 1164602139 19:29569308-29569330 CCTGCATTTCAGAGGATGCAACT No data
Right 1164602144 19:29569330-29569352 TCCTGCTTTTCCTGGGGGACAGG No data
1164602139_1164602141 -8 Left 1164602139 19:29569308-29569330 CCTGCATTTCAGAGGATGCAACT No data
Right 1164602141 19:29569323-29569345 ATGCAACTCCTGCTTTTCCTGGG No data
1164602139_1164602140 -9 Left 1164602139 19:29569308-29569330 CCTGCATTTCAGAGGATGCAACT No data
Right 1164602140 19:29569322-29569344 GATGCAACTCCTGCTTTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164602139 Original CRISPR AGTTGCATCCTCTGAAATGC AGG (reversed) Intergenic
No off target data available for this crispr