ID: 1164602141

View in Genome Browser
Species Human (GRCh38)
Location 19:29569323-29569345
Sequence ATGCAACTCCTGCTTTTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164602139_1164602141 -8 Left 1164602139 19:29569308-29569330 CCTGCATTTCAGAGGATGCAACT No data
Right 1164602141 19:29569323-29569345 ATGCAACTCCTGCTTTTCCTGGG No data
1164602136_1164602141 24 Left 1164602136 19:29569276-29569298 CCCACTTTGGGTGACACTGGGCA No data
Right 1164602141 19:29569323-29569345 ATGCAACTCCTGCTTTTCCTGGG No data
1164602137_1164602141 23 Left 1164602137 19:29569277-29569299 CCACTTTGGGTGACACTGGGCAT No data
Right 1164602141 19:29569323-29569345 ATGCAACTCCTGCTTTTCCTGGG No data
1164602135_1164602141 25 Left 1164602135 19:29569275-29569297 CCCCACTTTGGGTGACACTGGGC No data
Right 1164602141 19:29569323-29569345 ATGCAACTCCTGCTTTTCCTGGG No data
1164602131_1164602141 30 Left 1164602131 19:29569270-29569292 CCCATCCCCACTTTGGGTGACAC No data
Right 1164602141 19:29569323-29569345 ATGCAACTCCTGCTTTTCCTGGG No data
1164602132_1164602141 29 Left 1164602132 19:29569271-29569293 CCATCCCCACTTTGGGTGACACT No data
Right 1164602141 19:29569323-29569345 ATGCAACTCCTGCTTTTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164602141 Original CRISPR ATGCAACTCCTGCTTTTCCT GGG Intergenic
No off target data available for this crispr