ID: 1164602143

View in Genome Browser
Species Human (GRCh38)
Location 19:29569325-29569347
Sequence GCAACTCCTGCTTTTCCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164602137_1164602143 25 Left 1164602137 19:29569277-29569299 CCACTTTGGGTGACACTGGGCAT No data
Right 1164602143 19:29569325-29569347 GCAACTCCTGCTTTTCCTGGGGG No data
1164602135_1164602143 27 Left 1164602135 19:29569275-29569297 CCCCACTTTGGGTGACACTGGGC No data
Right 1164602143 19:29569325-29569347 GCAACTCCTGCTTTTCCTGGGGG No data
1164602139_1164602143 -6 Left 1164602139 19:29569308-29569330 CCTGCATTTCAGAGGATGCAACT No data
Right 1164602143 19:29569325-29569347 GCAACTCCTGCTTTTCCTGGGGG No data
1164602136_1164602143 26 Left 1164602136 19:29569276-29569298 CCCACTTTGGGTGACACTGGGCA No data
Right 1164602143 19:29569325-29569347 GCAACTCCTGCTTTTCCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164602143 Original CRISPR GCAACTCCTGCTTTTCCTGG GGG Intergenic
No off target data available for this crispr