ID: 1164602144

View in Genome Browser
Species Human (GRCh38)
Location 19:29569330-29569352
Sequence TCCTGCTTTTCCTGGGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164602139_1164602144 -1 Left 1164602139 19:29569308-29569330 CCTGCATTTCAGAGGATGCAACT No data
Right 1164602144 19:29569330-29569352 TCCTGCTTTTCCTGGGGGACAGG No data
1164602137_1164602144 30 Left 1164602137 19:29569277-29569299 CCACTTTGGGTGACACTGGGCAT No data
Right 1164602144 19:29569330-29569352 TCCTGCTTTTCCTGGGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164602144 Original CRISPR TCCTGCTTTTCCTGGGGGAC AGG Intergenic
No off target data available for this crispr