ID: 1164602146

View in Genome Browser
Species Human (GRCh38)
Location 19:29569333-29569355
Sequence TGCTTTTCCTGGGGGACAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164602139_1164602146 2 Left 1164602139 19:29569308-29569330 CCTGCATTTCAGAGGATGCAACT No data
Right 1164602146 19:29569333-29569355 TGCTTTTCCTGGGGGACAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164602146 Original CRISPR TGCTTTTCCTGGGGGACAGG TGG Intergenic
No off target data available for this crispr