ID: 1164602971

View in Genome Browser
Species Human (GRCh38)
Location 19:29576006-29576028
Sequence CCACTTCTGGTGACAGCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164602971_1164602975 3 Left 1164602971 19:29576006-29576028 CCAGCGGCTGTCACCAGAAGTGG No data
Right 1164602975 19:29576032-29576054 CCTCATTGCATCTCATTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164602971 Original CRISPR CCACTTCTGGTGACAGCCGC TGG (reversed) Intergenic
No off target data available for this crispr