ID: 1164612244

View in Genome Browser
Species Human (GRCh38)
Location 19:29640411-29640433
Sequence TGGGCTGTCCACAGGCACCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164612238_1164612244 -3 Left 1164612238 19:29640391-29640413 CCCTGATGTTGCCGGTGGGTTGG No data
Right 1164612244 19:29640411-29640433 TGGGCTGTCCACAGGCACCGTGG No data
1164612233_1164612244 22 Left 1164612233 19:29640366-29640388 CCTGTGGGGTCTTACAGCACTTC No data
Right 1164612244 19:29640411-29640433 TGGGCTGTCCACAGGCACCGTGG No data
1164612240_1164612244 -4 Left 1164612240 19:29640392-29640414 CCTGATGTTGCCGGTGGGTTGGG No data
Right 1164612244 19:29640411-29640433 TGGGCTGTCCACAGGCACCGTGG No data
1164612237_1164612244 -2 Left 1164612237 19:29640390-29640412 CCCCTGATGTTGCCGGTGGGTTG No data
Right 1164612244 19:29640411-29640433 TGGGCTGTCCACAGGCACCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164612244 Original CRISPR TGGGCTGTCCACAGGCACCG TGG Intergenic
No off target data available for this crispr