ID: 1164615021

View in Genome Browser
Species Human (GRCh38)
Location 19:29662629-29662651
Sequence AAACCCGGGTTCCCGCAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164615017_1164615021 -8 Left 1164615017 19:29662614-29662636 CCCACTGCTTTTCTGAAACCCGG No data
Right 1164615021 19:29662629-29662651 AAACCCGGGTTCCCGCAGTCTGG No data
1164615015_1164615021 -2 Left 1164615015 19:29662608-29662630 CCGAGCCCCACTGCTTTTCTGAA No data
Right 1164615021 19:29662629-29662651 AAACCCGGGTTCCCGCAGTCTGG No data
1164615011_1164615021 21 Left 1164615011 19:29662585-29662607 CCAGAATCCCTAACCTGAAAATG No data
Right 1164615021 19:29662629-29662651 AAACCCGGGTTCCCGCAGTCTGG No data
1164615014_1164615021 8 Left 1164615014 19:29662598-29662620 CCTGAAAATGCCGAGCCCCACTG No data
Right 1164615021 19:29662629-29662651 AAACCCGGGTTCCCGCAGTCTGG No data
1164615019_1164615021 -9 Left 1164615019 19:29662615-29662637 CCACTGCTTTTCTGAAACCCGGG No data
Right 1164615021 19:29662629-29662651 AAACCCGGGTTCCCGCAGTCTGG No data
1164615013_1164615021 13 Left 1164615013 19:29662593-29662615 CCTAACCTGAAAATGCCGAGCCC No data
Right 1164615021 19:29662629-29662651 AAACCCGGGTTCCCGCAGTCTGG No data
1164615012_1164615021 14 Left 1164615012 19:29662592-29662614 CCCTAACCTGAAAATGCCGAGCC No data
Right 1164615021 19:29662629-29662651 AAACCCGGGTTCCCGCAGTCTGG No data
1164615016_1164615021 -7 Left 1164615016 19:29662613-29662635 CCCCACTGCTTTTCTGAAACCCG No data
Right 1164615021 19:29662629-29662651 AAACCCGGGTTCCCGCAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164615021 Original CRISPR AAACCCGGGTTCCCGCAGTC TGG Intergenic
No off target data available for this crispr