ID: 1164616461

View in Genome Browser
Species Human (GRCh38)
Location 19:29669467-29669489
Sequence TCAGGAGCCCCGAAGAAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 139}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164616461_1164616473 27 Left 1164616461 19:29669467-29669489 CCTTGCTTCTTCGGGGCTCCTGA 0: 1
1: 0
2: 0
3: 8
4: 139
Right 1164616473 19:29669517-29669539 TGCCATGTGGTCACCCTATCAGG 0: 1
1: 0
2: 0
3: 3
4: 78
1164616461_1164616466 3 Left 1164616461 19:29669467-29669489 CCTTGCTTCTTCGGGGCTCCTGA 0: 1
1: 0
2: 0
3: 8
4: 139
Right 1164616466 19:29669493-29669515 CCCCTGCAGGTGCCCAGGCCTGG 0: 1
1: 0
2: 9
3: 75
4: 601
1164616461_1164616464 -2 Left 1164616461 19:29669467-29669489 CCTTGCTTCTTCGGGGCTCCTGA 0: 1
1: 0
2: 0
3: 8
4: 139
Right 1164616464 19:29669488-29669510 GACATCCCCTGCAGGTGCCCAGG 0: 1
1: 0
2: 0
3: 16
4: 204
1164616461_1164616462 -10 Left 1164616461 19:29669467-29669489 CCTTGCTTCTTCGGGGCTCCTGA 0: 1
1: 0
2: 0
3: 8
4: 139
Right 1164616462 19:29669480-29669502 GGGCTCCTGACATCCCCTGCAGG 0: 1
1: 0
2: 4
3: 29
4: 266
1164616461_1164616469 14 Left 1164616461 19:29669467-29669489 CCTTGCTTCTTCGGGGCTCCTGA 0: 1
1: 0
2: 0
3: 8
4: 139
Right 1164616469 19:29669504-29669526 GCCCAGGCCTGGATGCCATGTGG 0: 1
1: 0
2: 3
3: 33
4: 329

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164616461 Original CRISPR TCAGGAGCCCCGAAGAAGCA AGG (reversed) Intronic
900338754 1:2177800-2177822 GCAGCAGCCAGGAAGAAGCAGGG - Intronic
900936277 1:5768213-5768235 GCAGGAGCCCGGAGGAAGCCGGG - Intergenic
901038500 1:6350282-6350304 TCAGGAGTCCCAGAGAAGCCAGG + Intronic
902053759 1:13583881-13583903 GCAGGAGCCCCGGAGAGGGAGGG - Exonic
903003764 1:20284764-20284786 TCAGTACCCCCAAAGAATCATGG - Intergenic
903569998 1:24297318-24297340 GCAGGAGCCAGGAACAAGCAGGG + Intergenic
905253095 1:36662367-36662389 CCAGAAGCCAGGAAGAAGCAAGG - Intergenic
906262904 1:44406929-44406951 GCAGGAGTCCCGAAGTAGCGGGG + Intronic
906555712 1:46711322-46711344 TCAGGTACCCCGAAGGGGCAAGG + Intronic
907960760 1:59278716-59278738 CCAGGAGACCAGAAGAATCATGG - Intergenic
909280303 1:73742721-73742743 TCAAGAGGCTAGAAGAAGCATGG - Intergenic
915433373 1:155884322-155884344 TCAGTAGACCCAAAGATGCAAGG - Exonic
915963121 1:160283556-160283578 TCTGGGGCCCCGAAGCATCAGGG + Exonic
916963674 1:169913530-169913552 CCAGAAGCCAGGAAGAAGCAAGG + Intergenic
919728973 1:200900933-200900955 TCAGGACCCCCTAAGCAGCCTGG + Exonic
919802670 1:201363007-201363029 TCAGGAGCCCCCAAGGAGGCTGG - Intronic
924568947 1:245220548-245220570 TCAGGCACCCCGAAGGAGTAAGG + Intronic
1067233052 10:44425466-44425488 TCAGGAGCCCCCAAAAGCCATGG - Intergenic
1069942767 10:71966207-71966229 TCAGGAGCCAGGAAGAAAAACGG - Intronic
1070742254 10:78910911-78910933 TCAGGAGCCCCGGGGGAGCAGGG - Intergenic
1072682044 10:97514630-97514652 TCAGGAGCCCCGAGGAACCGGGG + Intronic
1077213949 11:1387473-1387495 GCAGGAGCCCCAAAGGAGCCAGG - Intergenic
1077420064 11:2445868-2445890 TCAGGAGCCCCCAAGAGAGAAGG + Intronic
1078928689 11:15896612-15896634 TCAGGAGCTCTGGAGAAGCTGGG - Intergenic
1083036340 11:59640960-59640982 TCAGGAGCCCCGGACCAGCCTGG + Intronic
1083752000 11:64766053-64766075 CCAGGAGCCCCTCAGATGCAAGG - Intronic
1083968725 11:66059264-66059286 TCTGCAGCCCCCAAGAAGAAGGG + Exonic
1084639332 11:70415127-70415149 TCAGGAGCCTGGAGGGAGCAGGG + Intronic
1085690422 11:78659705-78659727 CCAGGAGCCCCAAGGAAGCACGG - Intronic
1087127074 11:94639007-94639029 TCAAAAGCCCGGAAGAAGGAAGG - Intergenic
1089829998 11:121318894-121318916 TCAGGAGGCCAGAAGAGACAAGG + Intergenic
1090923060 11:131224185-131224207 TCTGCAGCCCAGAAGAAGCTAGG + Intergenic
1094493647 12:30976480-30976502 TGAGGAGCCTCTGAGAAGCAGGG - Intronic
1096355980 12:50941390-50941412 TCAGGAGCCCAGAATATGAAAGG - Intergenic
1096472493 12:51888392-51888414 TCAGGAGCCCTAAGCAAGCAGGG - Intronic
1099768126 12:87016743-87016765 TCAGGAGAAATGAAGAAGCAGGG + Intergenic
1102611916 12:114119796-114119818 CCAGGAGCCAGGAAGAATCAAGG + Intergenic
1103900072 12:124298969-124298991 TGAGGAGCCACAAAGAGGCAGGG + Intronic
1112090541 13:96078582-96078604 TCAGGAGTCGGGAAGGAGCAAGG + Intergenic
1113759113 13:112835412-112835434 CCAGGAGCCCCGCCGAATCAAGG - Intronic
1115062963 14:29216498-29216520 TCAAGAGCCTCGCAGGAGCATGG - Intergenic
1117742020 14:58828352-58828374 TCAGGAGCTCCCCGGAAGCATGG - Intergenic
1118950676 14:70433997-70434019 TCAGGGACTTCGAAGAAGCATGG - Intergenic
1121706499 14:95999788-95999810 ACAGGATCCCCCAAGAAGAAAGG + Intergenic
1122753684 14:103959423-103959445 TCTGGAGCACTGAAGAAGTAAGG + Intronic
1123007373 14:105330333-105330355 ACAGGAGCCTCCAAGAAGCCTGG + Intronic
1129710529 15:77818519-77818541 TCAGGAGCTCCCAAGAGGCCGGG - Intronic
1130092050 15:80829274-80829296 TCAGGAACCCAGAAGACGGAAGG - Intronic
1131074226 15:89484873-89484895 TCAGGAGGGCCGAGGAAGCTTGG + Intronic
1132302671 15:100785754-100785776 TCACAAGCCCCTAAGAAGCTGGG + Intergenic
1133830633 16:9320281-9320303 TCAGGAACTCTGAAGAAGAAGGG - Intergenic
1134310395 16:13070881-13070903 TGAGGAGCCCCGAGGAAAGAGGG + Intronic
1135408937 16:22218604-22218626 TGAGGACCCCTGAAGAAGCTTGG + Intronic
1137662836 16:50224259-50224281 TTATGAGCCCCTAAAAAGCAAGG - Intronic
1137767253 16:50987441-50987463 TCAGGAGACACACAGAAGCAAGG - Intergenic
1138613765 16:58148111-58148133 CCAGAAGCCAGGAAGAAGCAAGG - Intergenic
1142078088 16:88131959-88131981 TCAGCAGCCCCGGAGATGCGCGG - Intergenic
1143289501 17:5818235-5818257 TCCGCAGACCCAAAGAAGCAGGG - Intronic
1143965742 17:10755556-10755578 TCAGCAGCCTCTAAGAGGCAGGG - Intergenic
1145225300 17:21123474-21123496 ACAGTAGCCCCGTAGAACCAGGG - Intronic
1146445729 17:32931510-32931532 TCAGGAGCCCTCTGGAAGCATGG + Exonic
1147147345 17:38492796-38492818 TCAGGATCCCCGACGCTGCAGGG - Intronic
1147321676 17:39650341-39650363 TCAGGAGCCAGGAAGAGGCAAGG + Intronic
1147886762 17:43689526-43689548 TGGGGAGACCCCAAGAAGCAGGG + Intergenic
1148081833 17:44971038-44971060 TCAGGAGTTCCGAACAAGCCTGG + Intergenic
1149461400 17:56833186-56833208 TCAGCACCCCCGAAGAAACACGG - Exonic
1150782156 17:68133012-68133034 TGTGCAGCCCCTAAGAAGCAAGG + Intergenic
1150828238 17:68495333-68495355 TCAGGAACCTAGAAGAAGCCTGG - Intergenic
1152226170 17:79093925-79093947 CCAGGAGCCCCCAGGAAGCCAGG + Intronic
1153729560 18:7995991-7996013 TCAGAAGCCCAGAAAAACCAAGG - Intronic
1158613065 18:58961001-58961023 TCAGCAGCCACAAAGAAGGATGG - Intronic
1159663784 18:71131728-71131750 TCTGGAGCAGCGCAGAAGCAGGG - Intergenic
1160531705 18:79568997-79569019 TCAGGAGCCTGGCAGGAGCATGG - Intergenic
1160728441 19:629293-629315 TCACGAGCCCCGAGAAAGAACGG + Intronic
1161040559 19:2108868-2108890 TCAGGAGGCCTGTAGGAGCAGGG + Intronic
1161496935 19:4591560-4591582 TGGGGATCCCCGAAGAAGCTGGG - Intergenic
1164616461 19:29669467-29669489 TCAGGAGCCCCGAAGAAGCAAGG - Intronic
1165493718 19:36140244-36140266 TCAGGAGCCCCCCAGATCCATGG + Intronic
1166682307 19:44776648-44776670 TCCTGAGTCCCGAAGAAGCCAGG - Intergenic
1166906936 19:46117908-46117930 TTAGGAGCACCTAACAAGCAGGG - Intergenic
927730676 2:25468709-25468731 TCATGAGCCCCGAAGACAGAAGG - Intronic
929378965 2:41326589-41326611 TCAGAAGCCCAGAAGTAGCTAGG + Intergenic
929538004 2:42796531-42796553 TTTGGAGCCCGGAAGAACCAGGG - Intergenic
929634945 2:43509913-43509935 ACAGGAGTGTCGAAGAAGCAAGG - Intronic
931129233 2:59314949-59314971 TCAGGAGCTCCAATTAAGCAAGG + Intergenic
933233436 2:79836631-79836653 CCAGGAGCTAGGAAGAAGCAAGG - Intronic
939181624 2:138809878-138809900 TCAGGACCTCGGAAGAAGGATGG - Intergenic
1170500120 20:16966890-16966912 TCTGAGGCCCAGAAGAAGCAAGG - Intergenic
1172799160 20:37564323-37564345 CCAGGAGCCCCGAAGAGCAAAGG - Intergenic
1172901976 20:38341905-38341927 CCAGGAGCCCCCATGGAGCAGGG - Intergenic
1173036602 20:39417628-39417650 TCAGGAGACAAGAAGAAACATGG - Intergenic
1175761157 20:61562884-61562906 TCAGGAGCCGTGAAGACTCAGGG - Intronic
1179979281 21:44888006-44888028 ACATGAGACCTGAAGAAGCAGGG + Intronic
1182125377 22:27811841-27811863 TCAGGAGCACCCAACCAGCAGGG + Intergenic
1182352960 22:29709186-29709208 GCAGGAGCCCGGGAGAAGTAGGG + Intergenic
1183676288 22:39300572-39300594 TCAGGAGCCCTGGGGCAGCAAGG + Intergenic
1184693041 22:46126008-46126030 TCAGGAGCCCAGAGGAAGCCTGG + Intergenic
1185322814 22:50209701-50209723 CCAGGAGCCCCCAAGGTGCAGGG - Intronic
1185395463 22:50584761-50584783 CCAGGAGCCCTGAAGCATCATGG + Intronic
950264316 3:11563070-11563092 TCAAGAGCCCTGAAGAGTCAAGG + Intronic
953493928 3:43370596-43370618 TAAGGATCCCCAAAGAAGCCAGG - Intronic
957037828 3:75311427-75311449 GCAGGAGATCAGAAGAAGCAAGG - Intergenic
959038042 3:101387728-101387750 TCAGGCTCCCGGAAGAATCATGG - Intronic
960126338 3:114002364-114002386 TCAGGAGTTCTGAAAAAGCAAGG + Intronic
960212315 3:114984907-114984929 TCAAAAGCCCCAAACAAGCATGG - Intronic
965781296 3:172288937-172288959 GCAGGAGGCACGAACAAGCATGG - Intronic
965802023 3:172504534-172504556 TCAGAAGCTCGGAAGAAACAAGG - Intergenic
965879325 3:173369956-173369978 CCAGGAGCTCAGGAGAAGCAGGG - Intergenic
967598951 3:191361522-191361544 TCAGGAGCTAGGAAGAGGCAAGG - Intronic
968540759 4:1167247-1167269 ACGGGGGCCCCTAAGAAGCAAGG + Exonic
973631540 4:52825128-52825150 GCAGGAGCCCTGGAGAAGCCAGG + Intergenic
977987893 4:103406232-103406254 CCAGAAGCCAGGAAGAAGCAAGG - Intergenic
979337298 4:119477869-119477891 TGAGGAGACCCTATGAAGCAAGG + Intergenic
980885687 4:138759906-138759928 TTAGAGGCCCCTAAGAAGCATGG + Intergenic
992529305 5:77639408-77639430 GCAGGAGCCGGGAAGAAGCCCGG - Exonic
999368231 5:151036844-151036866 TTGGGAGCCCAGAAGGAGCAGGG - Exonic
1000193886 5:158939457-158939479 TCAGCAGACCAGAATAAGCAAGG + Intronic
1001154774 5:169263456-169263478 CCAGGAGCCAGGAAGGAGCAAGG + Intronic
1017794713 6:157833661-157833683 TCAGGAGCTTAGAAGAGGCAGGG + Intronic
1018267856 6:162044372-162044394 GCAGGAGCCCCGTGGCAGCAGGG - Intronic
1023284751 7:38607546-38607568 TCAGGACCCCCGGTGAAGCAAGG + Intronic
1023821247 7:43981791-43981813 TGAGGGGCCCCGCAGGAGCAGGG - Intergenic
1028312586 7:89357477-89357499 TCAGGAGCCCCAAATAATCACGG + Intergenic
1029698248 7:102228829-102228851 TCTGGAGCCCCGAGGATGCCAGG - Intronic
1029749516 7:102535215-102535237 TGAGGGGCCCCGCAGGAGCAGGG - Intergenic
1029767464 7:102634318-102634340 TGAGGGGCCCCGCAGGAGCAGGG - Intronic
1032507408 7:132446030-132446052 CCAGGAGCCCCGATGGAGGAAGG + Intronic
1034441931 7:151090103-151090125 CCAGGAGCCCCAAAGGAGCCCGG + Intronic
1034917950 7:155056432-155056454 TCAGAAGCCTCCCAGAAGCAGGG + Intergenic
1037689330 8:21169567-21169589 TCATGAGCCCACAAGATGCAAGG - Intergenic
1038281275 8:26167444-26167466 ACAGGAGCCCGGAAGCAGAAAGG + Intergenic
1041985626 8:63919412-63919434 TCAGGAGCAAGGAAGAGGCAAGG - Intergenic
1046316388 8:112508475-112508497 TCAGGAGCCTAGAATAAGGAGGG - Intronic
1046952475 8:120031585-120031607 GCAGGAGCTCTGAGGAAGCATGG - Intronic
1049495792 8:142931778-142931800 TCAGGAGCCCCAAATAGGGAGGG - Intergenic
1056627435 9:88265100-88265122 TCAGGAGCCACCATGTAGCAGGG + Intergenic
1057478675 9:95426885-95426907 GCAGGAGCCCCGCAGGAGCCAGG - Intergenic
1059940946 9:119359309-119359331 TCAGCACCCCCGAAGTAGCCAGG + Intronic
1062161360 9:135082007-135082029 ACACGAGCACAGAAGAAGCAGGG - Intronic
1062202222 9:135309606-135309628 TCAGGTGGGCCGAAGAAGCTTGG - Intergenic
1189246021 X:39564183-39564205 CCAGAAGCTCTGAAGAAGCAAGG - Intergenic
1189735973 X:44070250-44070272 TCAGGAGCCCGAAAGAATCCTGG + Intergenic
1189899656 X:45693021-45693043 TCAGGAGTCACAAAGAAGAAAGG + Intergenic
1191101374 X:56732154-56732176 TCAGGACACCAGAAAAAGCAGGG - Intergenic
1192845908 X:74906992-74907014 TAAGGTGCCCTGAAAAAGCAAGG - Intronic
1197025545 X:121744585-121744607 TCTGAAGCCCCCAAGAATCAGGG - Intergenic
1198955918 X:142130386-142130408 TCAGTAGCCCAGACGGAGCAAGG - Intergenic
1199691571 X:150312824-150312846 CCAGGAGCCCCGAAGAATGTGGG + Intergenic