ID: 1164617155

View in Genome Browser
Species Human (GRCh38)
Location 19:29674091-29674113
Sequence GGTCACACTGGAGCTGTTGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 162}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164617145_1164617155 7 Left 1164617145 19:29674061-29674083 CCGCAGCCAGCACATCATCCCCC 0: 1
1: 0
2: 4
3: 34
4: 340
Right 1164617155 19:29674091-29674113 GGTCACACTGGAGCTGTTGCCGG 0: 1
1: 0
2: 0
3: 17
4: 162
1164617147_1164617155 1 Left 1164617147 19:29674067-29674089 CCAGCACATCATCCCCCTGGAGG 0: 1
1: 0
2: 2
3: 17
4: 239
Right 1164617155 19:29674091-29674113 GGTCACACTGGAGCTGTTGCCGG 0: 1
1: 0
2: 0
3: 17
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164617155 Original CRISPR GGTCACACTGGAGCTGTTGC CGG Exonic
901761804 1:11476835-11476857 GGTGGCAGTGGAGCTGGTGCAGG - Intergenic
902396474 1:16134740-16134762 GGTCTCACGGGAGGTATTGCAGG + Intronic
903235963 1:21951017-21951039 GGTCACGCTGGTGCTGGGGCTGG + Intergenic
907053710 1:51345908-51345930 CTTCACACTGGAGCTGGAGCAGG - Intergenic
907185567 1:52606743-52606765 GGTCTCGCTGCAGCTGCTGCAGG - Exonic
907215164 1:52857203-52857225 GGAGACACTGGAGGTTTTGCTGG - Exonic
907334162 1:53689535-53689557 GGTCACAGTGCAGATCTTGCTGG - Intronic
908511038 1:64850225-64850247 GGCTGCCCTGGAGCTGTTGCTGG - Intronic
910491883 1:87781695-87781717 GGACACACTGGACCTGCTGAGGG - Intergenic
912505536 1:110153106-110153128 AGTCACCCCAGAGCTGTTGCAGG - Intronic
916955789 1:169833207-169833229 GGTCACATTGGAACTGTTGTAGG + Intronic
920451264 1:206062771-206062793 GTTCCCACGGGAGCTGTTCCTGG - Intronic
922186231 1:223277365-223277387 GAGCAAACTGGAGCTGTGGCAGG + Intronic
922932912 1:229403989-229404011 GGTCACTTTAGAGCTGATGCCGG - Intergenic
1063039412 10:2321625-2321647 GCTCACCCTGTAGCTATTGCAGG + Intergenic
1063461716 10:6219087-6219109 GGTCACACTGGGGCTGCCTCAGG + Intronic
1066475623 10:35744974-35744996 GATCACACTGTAGCTGAAGCAGG + Intergenic
1067742256 10:48904628-48904650 TGTCAGTCTGGAGCTGTTGGGGG - Intronic
1069991088 10:72316636-72316658 GGTCTCACGGGAGCTGCTGTGGG + Intergenic
1070128027 10:73637582-73637604 ACTCACCCTGGAGCTGTTGCGGG + Intronic
1072421980 10:95296956-95296978 AGTCTCTCTGGACCTGTTGCAGG - Intergenic
1073065680 10:100757835-100757857 GGGCACAGGGGAGCTGTTGAGGG + Intronic
1075962583 10:126582085-126582107 GGTCACCCTGCAGCTGCTGTGGG + Intronic
1076982055 11:209853-209875 TGACACACTGGAGCTGACGCTGG + Exonic
1077846255 11:6027660-6027682 TGGGACAGTGGAGCTGTTGCTGG + Exonic
1079261302 11:18884558-18884580 GGTCTCACTGGAGCTCCTACAGG - Intergenic
1080405418 11:31974510-31974532 GGGCACCCTAGAGCTGTTGCAGG - Intronic
1081554775 11:44148480-44148502 GGTAACACTGGAGCATGTGCTGG - Intronic
1081600370 11:44488536-44488558 GGTGCCACTGGGGCTGGTGCTGG - Intergenic
1081610279 11:44558332-44558354 GCACACCTTGGAGCTGTTGCAGG - Intergenic
1083424259 11:62574965-62574987 GGTCAGACGGGAGCAGCTGCAGG + Intronic
1083627679 11:64079846-64079868 CCTCACTCTGGAGCTGTTGCTGG - Intronic
1084142074 11:67239298-67239320 GGTCACGGTGGAACTGCTGCAGG + Intronic
1087309239 11:96521180-96521202 GGTTGCACTGGAGGTGGTGCTGG + Intergenic
1087378005 11:97368160-97368182 GGGCACACTGGAGGTGGTGTTGG - Intergenic
1087560012 11:99776898-99776920 GTTCACATTGGAGCTGGGGCTGG - Intronic
1087860705 11:103150970-103150992 GGGCACTGGGGAGCTGTTGCTGG + Intronic
1089140119 11:116277888-116277910 TGTCACACAGGGGCTGTGGCAGG + Intergenic
1089243463 11:117100394-117100416 GGTAAAACTGCAGCTGTAGCTGG - Intergenic
1089562722 11:119352990-119353012 GGTCACACAAGAGCAGTTGCAGG + Intergenic
1091522270 12:1257584-1257606 GGTAACATTGGAGCTTTTGTTGG + Intronic
1092052288 12:5480480-5480502 GGTCTCCCTGCAGCTGTTGGCGG + Intronic
1092888783 12:12949670-12949692 CGTCCCACTGGGGCTGTCGCTGG + Exonic
1097162630 12:57059285-57059307 TGTCACTCTGGAGCACTTGCTGG + Exonic
1102521046 12:113477582-113477604 GGTCCCTCTGGAGCTGCAGCAGG + Intergenic
1104036782 12:125103116-125103138 GGACCCACTGGAGCTCCTGCGGG + Intronic
1113901296 13:113799779-113799801 GGTCACACTGCCGCTGTCGGTGG - Intronic
1115883506 14:37946093-37946115 GATCACACTGGAGATGGTGTTGG - Intronic
1121172453 14:91866546-91866568 GGTAACACGAGAGCTTTTGCAGG + Intronic
1121683832 14:95817010-95817032 GGTGACACAGGTGCTGTTACAGG - Intergenic
1122063202 14:99150930-99150952 GGACACAAGGGAGCTCTTGCGGG - Intergenic
1122081158 14:99268858-99268880 GCTGACACTGGAGCAGTGGCAGG - Intronic
1123131894 14:105994062-105994084 GGTCACACTGGAGGAGGTGTTGG + Intergenic
1124364801 15:29063918-29063940 GGCCACACTGGAGCTGCTGGGGG + Intronic
1125598618 15:40903203-40903225 GGTCAGCCTTGAGCTGTTCCCGG - Exonic
1127562437 15:60152653-60152675 ATTCACACTGTAGCTGTTGAGGG - Intergenic
1132588358 16:715779-715801 GGGCGCCCTGGAGCTGCTGCTGG + Exonic
1132589711 16:721328-721350 GGGCGCGCTGGAGCTGCTGCAGG + Exonic
1132804028 16:1767478-1767500 GGTGGCCCTGGAGCTGTGGCAGG + Intronic
1133342523 16:5045891-5045913 GGTCAACCTGGAGGTGTTCCAGG + Intronic
1134779164 16:16879808-16879830 GGTAACACAGGAGCTGTGCCTGG + Intergenic
1135928020 16:26712275-26712297 TGTCAGCCTGGAGCTGTTGATGG - Intergenic
1136681886 16:31971610-31971632 GGGAACACTGGAGCTGTGGGAGG - Intergenic
1136782195 16:32913112-32913134 GGGAACACTGGAGCTGTGGGAGG - Intergenic
1136887593 16:33940740-33940762 GGGAACACTGGAGCTGTGGGAGG + Intergenic
1137667326 16:50259359-50259381 GGTCACACTGGGCCGGGTGCAGG + Intronic
1140188751 16:72796723-72796745 AGTCACACTCGAGCTTTTCCAGG + Exonic
1141012765 16:80418248-80418270 GGTCTCACTGGAGAAGTTTCTGG + Intergenic
1203084856 16_KI270728v1_random:1177098-1177120 GGGAACACTGGAGCTGTGGGAGG - Intergenic
1142490871 17:278628-278650 GGGGACACTGGGGCAGTTGCTGG - Intronic
1142727929 17:1830042-1830064 GGGGAAGCTGGAGCTGTTGCGGG + Exonic
1142760041 17:2036730-2036752 GGCCACTCTCCAGCTGTTGCGGG + Intronic
1143053040 17:4142592-4142614 TGTCACTCTGGAGCAGTTCCGGG - Exonic
1143107414 17:4536588-4536610 GGTCAGCCTGGAGCTGTGGGAGG + Intronic
1143509930 17:7389888-7389910 GGTCCCCCTGCAGCTGTTGATGG + Exonic
1144855562 17:18265487-18265509 CATCTCACTGGAGCTGTTCCAGG + Exonic
1150056713 17:62023504-62023526 GGACACAAGGGAGCTGCTGCTGG + Intronic
1150432620 17:65130620-65130642 GGTCAGATTGGAACTGTTGAAGG - Intergenic
1151397912 17:73836757-73836779 GGCCACACGGGAGCTGGTGGGGG + Intergenic
1151422455 17:74007401-74007423 GGTCACAGTGGAGCTGCTCCTGG + Intergenic
1151505604 17:74525111-74525133 GGTCATCCTGCTGCTGTTGCTGG - Intronic
1151557171 17:74852395-74852417 GGTCACGCTGGAGCTGGGCCCGG - Exonic
1152751445 17:82064296-82064318 GGTCACACTGGACCTCTCGTAGG - Intronic
1152938854 17:83155156-83155178 GGTGACAGTGGGGTTGTTGCTGG + Intergenic
1153673303 18:7432959-7432981 GCTCACCCTGGAGCCGCTGCAGG + Intergenic
1160103400 18:75945611-75945633 AGTCACAGTGGAGCTGCTGTGGG - Intergenic
1163471562 19:17500349-17500371 GGACACAATGGAGCTGCTGCGGG + Exonic
1164617155 19:29674091-29674113 GGTCACACTGGAGCTGTTGCCGG + Exonic
1165159344 19:33806721-33806743 GGTGACTCTGGAACTGTTCCAGG - Intronic
1165290302 19:34878514-34878536 TGTTGCACTGGAGCTGCTGCTGG + Intergenic
1166232480 19:41433264-41433286 GGTCTCACTGGAGGTGGTGGAGG + Exonic
1166888580 19:45975745-45975767 AGTCACACTGGCCCTGCTGCAGG + Intergenic
1167765409 19:51479200-51479222 GGACACACTGGACCTGTTCAAGG - Intronic
928149826 2:28816665-28816687 GGTCACACTAGAGAAGTTTCAGG + Intronic
929981892 2:46689048-46689070 GGTAGCACTAGAGCTGTTTCAGG + Intergenic
932175857 2:69601179-69601201 GGGCACACTTTAGCTATTGCAGG - Intronic
933658733 2:84909392-84909414 GGTCATAGTGGTGCTGTTGATGG - Intergenic
938787452 2:134645308-134645330 GGGCACAGTAGAGCTGCTGCTGG - Intronic
944939338 2:204606566-204606588 GGTCACACTGAAGTTCTTGTAGG + Intronic
944995798 2:205292102-205292124 GGTCCCACTGGAGCTCTACCTGG - Intronic
945254515 2:207792307-207792329 GCTCACAGTTGAGCTGTGGCGGG - Intergenic
946417509 2:219547780-219547802 GGGTCCACTGGGGCTGTTGCTGG + Exonic
948168045 2:235878239-235878261 GGTTACACTGAACCTGCTGCAGG - Intronic
948344468 2:237283689-237283711 GGTGACACTGCAGCTGTTTTTGG - Intergenic
1169786045 20:9360120-9360142 GGTCACAGAGCAGCTGGTGCAGG - Intronic
1171053381 20:21882879-21882901 GGTCATACTGGAGGTGGTGTTGG + Intergenic
1175368123 20:58469387-58469409 GGTCACACTGGACCTCTTGATGG + Intronic
1176110903 20:63410293-63410315 GCTCAGCCTGGAGCTGCTGCTGG + Intronic
1176125762 20:63473760-63473782 GGTCCCTCTGGAGCTGCTGCTGG + Intergenic
1178898818 21:36583016-36583038 GGTGGCACTGGGGATGTTGCTGG - Intergenic
1179149617 21:38798695-38798717 AGTCACACAAGAGCTGTTGGAGG + Intergenic
1180595226 22:16968565-16968587 GGTAACACTGGAGCTGGACCTGG - Intronic
1181261239 22:21599373-21599395 GGGCACACTGGAGTTGTTTTGGG + Intronic
1182151204 22:28028355-28028377 GTGCTCACTGGAGCTATTGCAGG + Intronic
1183363087 22:37393096-37393118 GGTCACACAGCAGCTGTCACTGG - Intronic
1183948109 22:41338278-41338300 GGCCACAGTGGCGCTGTGGCTGG - Intronic
1184458602 22:44625041-44625063 GGGTACACTGGTGCTGCTGCCGG - Intergenic
1184804923 22:46788557-46788579 GGTCCCAGTGGGGCTGGTGCTGG - Intronic
1185251075 22:49802015-49802037 AGTCACAGAGGAGCTGTTGAAGG - Intronic
950089246 3:10283821-10283843 GGTCTCACATGAGCTGTAGCTGG - Intronic
950271528 3:11619938-11619960 GGTCACACTGGAGACTTTTCAGG + Intronic
952919764 3:38276393-38276415 AGTCACACTGCAGCTCTTACCGG - Exonic
953404877 3:42655116-42655138 GGTCACACAGGAGTTGGTACGGG - Intronic
953441855 3:42925086-42925108 TGTCACACTGGAATGGTTGCAGG - Intronic
961122848 3:124387849-124387871 TGTCACAGAGGAGCTGTTCCAGG + Intronic
964725149 3:159806706-159806728 GCTCACACTGGAGAAGCTGCGGG + Intronic
966552414 3:181219780-181219802 GGTGACATTGAAGCTGTTACAGG - Intergenic
967939596 3:194755954-194755976 TGACACACTGGAGCAGTGGCTGG + Intergenic
969466056 4:7357096-7357118 GGTCCGGCTGGAGCTCTTGCTGG + Intronic
969724827 4:8912799-8912821 GGTCCCACAGAAGATGTTGCTGG + Intergenic
970286320 4:14520324-14520346 GCTCACACTAGATCTGTTACAGG + Intergenic
970491822 4:16582797-16582819 GGTCCCAGTGGAGCTGTGGCTGG - Intronic
971846439 4:31924583-31924605 GGTCATCCTGAAGGTGTTGCAGG + Intergenic
975493434 4:75012905-75012927 GGTCACAGTGGAGCTATGGTTGG - Exonic
976948436 4:90799125-90799147 GGTCACACTGGAGGTGATGTTGG + Intronic
988916271 5:35896516-35896538 GGTCACAAGGGAACTGTAGCTGG - Intergenic
990781767 5:59372652-59372674 AGTCACACTGGAGGTGGTGTTGG - Intronic
996471963 5:123871493-123871515 GGTGAACCTGGGGCTGTTGCTGG + Intergenic
997839815 5:137229062-137229084 GGTCAGACTGCAGCTGCTCCTGG + Intronic
998008013 5:138670228-138670250 GTGCACACTGGGACTGTTGCTGG - Intronic
999518224 5:152322228-152322250 GCTCTCACTGGAGCAGTGGCAGG + Intergenic
1003213328 6:4087544-4087566 TATCACGCTGGAGCTGCTGCTGG - Exonic
1006003828 6:30987269-30987291 GGTCCCACTGGAGGTCGTGCTGG - Exonic
1006389543 6:33750433-33750455 GGTGACACTGGAGCTGGAGCTGG - Intergenic
1008489297 6:52068769-52068791 GGTCAAAATGCAGCTGTTGCAGG + Intronic
1011556391 6:88574619-88574641 GGCCACTCTGGAGGTGTTGGTGG - Intergenic
1012477722 6:99633382-99633404 AGTCACCCTGGAGCTGGGGCAGG + Intergenic
1013863710 6:114667754-114667776 AGCCACTCTAGAGCTGTTGCTGG + Intergenic
1018793002 6:167163840-167163862 GGGGTCACAGGAGCTGTTGCCGG - Intronic
1019742643 7:2682449-2682471 GGCCTCCCTGGAGCTGTCGCTGG - Intronic
1022589377 7:31646539-31646561 GGTCACCCTGGAGCTGGCCCAGG - Intronic
1022794660 7:33722537-33722559 GGTCACACTGGGGCAGCAGCAGG - Intergenic
1023303973 7:38803891-38803913 GGACACAGTAGAGCTGTTGGTGG - Intronic
1023564590 7:41511174-41511196 GGTCACTCTGGCCCTTTTGCTGG + Intergenic
1024709129 7:51995756-51995778 GATCACAGTGGAGCTGTTCCAGG + Intergenic
1024968892 7:55050928-55050950 GGGCACACAGGAGGTGCTGCAGG - Intronic
1031463443 7:122079694-122079716 GGTCACAGAGGAGTTGTTTCTGG + Exonic
1032710072 7:134453401-134453423 TGTCAGCCTGGAGCTGCTGCAGG + Intronic
1033345614 7:140523482-140523504 GGACACACTGGAGCCACTGCAGG + Intronic
1034578898 7:152025803-152025825 GGTCGGACTGGGGCTGTGGCGGG + Intronic
1040510268 8:48087210-48087232 GGTCCTTCTGGAGCTGCTGCAGG + Intergenic
1041335078 8:56773112-56773134 GGTCAAATTGGACCTGTGGCTGG - Intergenic
1042306583 8:67339728-67339750 GGGCAACCTGGAGCTGTTCCTGG + Intronic
1044793549 8:95872643-95872665 GGTCACACTGGTGGTGGTGTTGG - Intergenic
1045672779 8:104575232-104575254 AGTCACACTGAAGCTGATGTTGG - Intronic
1048493873 8:134919562-134919584 GGTCAAACCTGAGCTGCTGCTGG - Intergenic
1048969469 8:139636808-139636830 GGTCACCTTGGAGCTGAGGCAGG - Intronic
1049317158 8:141975438-141975460 GGTCACCCAGGAGCAGGTGCAGG + Intergenic
1049463614 8:142741218-142741240 GGCCACACAGGAGCTGGAGCAGG + Exonic
1049581521 8:143413337-143413359 GGTCTCCCTGGCTCTGTTGCTGG - Intergenic
1049644021 8:143728077-143728099 GGTCCCACTGGTACTGCTGCTGG + Exonic
1049777922 8:144414980-144415002 CCACACACTGGAGCTGTTGCTGG + Exonic
1056973917 9:91233232-91233254 GGTGACACTGGAGCTGAGGCAGG + Intronic
1057277537 9:93683981-93684003 GTTCCCACTGGAGCTGAGGCAGG + Intergenic
1057671035 9:97088554-97088576 GCTCACACAGGAGCTGTAGAAGG - Intergenic
1058567937 9:106306970-106306992 GATCAGGCTGGAGATGTTGCTGG - Intergenic
1060244866 9:121936529-121936551 GCACACACTGGAGCTGGTGGGGG - Intronic
1191642406 X:63441694-63441716 GGTCATGCTGGAGATGGTGCTGG - Intergenic
1195174969 X:102306078-102306100 GGACTCACAGGAGCTGTTGTTGG + Intergenic
1195183896 X:102381015-102381037 GGACTCACAGGAGCTGTTGTTGG - Intronic