ID: 1164617347

View in Genome Browser
Species Human (GRCh38)
Location 19:29674983-29675005
Sequence CCCAGGTCTCCAGACATCTA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 135}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164617341_1164617347 -5 Left 1164617341 19:29674965-29674987 CCTCCTGAGCTGGACGACCCCAG 0: 1
1: 0
2: 1
3: 11
4: 128
Right 1164617347 19:29674983-29675005 CCCAGGTCTCCAGACATCTAGGG 0: 1
1: 0
2: 1
3: 15
4: 135
1164617340_1164617347 3 Left 1164617340 19:29674957-29674979 CCAGATGGCCTCCTGAGCTGGAC 0: 1
1: 0
2: 2
3: 11
4: 153
Right 1164617347 19:29674983-29675005 CCCAGGTCTCCAGACATCTAGGG 0: 1
1: 0
2: 1
3: 15
4: 135
1164617343_1164617347 -8 Left 1164617343 19:29674968-29674990 CCTGAGCTGGACGACCCCAGGTC 0: 1
1: 0
2: 0
3: 7
4: 86
Right 1164617347 19:29674983-29675005 CCCAGGTCTCCAGACATCTAGGG 0: 1
1: 0
2: 1
3: 15
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164617347 Original CRISPR CCCAGGTCTCCAGACATCTA GGG Exonic
900490895 1:2948651-2948673 CCCAGCTCTCCAGAAAGCTGGGG + Intergenic
900788832 1:4666376-4666398 CCCAGGACTGGAGCCATCTAGGG + Intronic
901638996 1:10683891-10683913 CCCACGTCCCCAAACATCTCTGG - Intronic
902727036 1:18344046-18344068 TCCAGCTCTCCAGAAATCCAAGG - Intronic
905284833 1:36872466-36872488 CACAGGTCTGCAGACATACACGG + Intronic
905659528 1:39710779-39710801 CCCAGGGTACCAGACACCTAAGG - Intronic
906077882 1:43065388-43065410 CCCAGGGCTACAGACGTCAAGGG + Intergenic
906586611 1:46984155-46984177 CCCAGGTTTGCAAACGTCTAAGG + Intergenic
906733860 1:48105668-48105690 CCCAGCTCTCCAGCCATCCCTGG + Intergenic
908942494 1:69452570-69452592 CCCAGGTCTACAGGCATCAGAGG - Intergenic
909935382 1:81545006-81545028 CCCAGGTCACGAGACATCCCTGG + Intronic
913329533 1:117655659-117655681 TCCAGGTCTCCAGAATTCTAAGG + Intergenic
914753986 1:150552947-150552969 CCAAGGTCCCCAGACACCTTCGG - Exonic
919922699 1:202175849-202175871 CCCAGGTCTCCTGACTTCCAGGG - Intergenic
920706116 1:208251850-208251872 CCCAGGTCTCCCGACTCCCAAGG - Intergenic
1063893007 10:10649701-10649723 CCCAGGACCCCAGATATCTCTGG + Intergenic
1069635501 10:69922602-69922624 CCCTGGTCCCCAGACATCCTGGG + Intronic
1070639269 10:78154856-78154878 CCCTGACCTGCAGACATCTATGG - Intergenic
1072152075 10:92691310-92691332 CCTAGGGCTCCAGACCTCGAAGG - Intronic
1075000381 10:118792593-118792615 CAGAGGTCTACAGTCATCTAAGG - Intergenic
1076803826 10:132845333-132845355 GCCATGTCTGCAGACATCTCTGG + Intronic
1077466295 11:2735281-2735303 CCCAGGGCCCCAGGCATCTCTGG - Intronic
1078092791 11:8277751-8277773 TCCAGGTCTCCAGTCATCAGTGG - Intergenic
1079241636 11:18726211-18726233 CCCAGGGGGCCAGACATTTAAGG - Intronic
1081372708 11:42323651-42323673 CCCAGCACTCCAGAAATCTTGGG + Intergenic
1081709097 11:45205562-45205584 CCCCTGACTCCAGACATCTGAGG - Intronic
1081716729 11:45255824-45255846 CTCAAGTTCCCAGACATCTATGG - Exonic
1082076170 11:47977968-47977990 CCCAGGTCTCCACAGATTCATGG - Intergenic
1085705842 11:78786329-78786351 CCCAGGATTCCAGACCTCTTGGG + Intronic
1087084018 11:94198399-94198421 CCCAGGTCTCCAGCCACCGCAGG - Intergenic
1089892606 11:121896499-121896521 CCCAAGTCTCCAGACAGGAATGG - Intergenic
1090418688 11:126558485-126558507 CCCAGGGCTCCAGACACCCAGGG - Intronic
1099785022 12:87251126-87251148 CCCAAGTTTCCAGACATGAAGGG + Intergenic
1100039415 12:90295605-90295627 CCCAGCTCTGCTGACATCTCAGG + Intergenic
1101959342 12:109236981-109237003 CCCAGGGCTCCAGATATTTGGGG - Intronic
1102020466 12:109678763-109678785 CCCAGGTCCGCAGACTTCTAAGG + Intergenic
1111992562 13:95131659-95131681 GCCAGGTCGCCTGACATCTTTGG - Intronic
1113471347 13:110548938-110548960 CCCAGGGCTCCAGCCAGGTAAGG + Intronic
1113566640 13:111323275-111323297 CCCAGGTCACCCGCCATCCAGGG - Intronic
1114871009 14:26658676-26658698 GCCAGCTCTCCAGACGTATATGG - Intergenic
1115768981 14:36651070-36651092 CCCACCACTCCAGGCATCTAGGG - Intergenic
1121444507 14:93970077-93970099 CCCAGGTTTGCAGACAGCCAGGG + Intronic
1122125633 14:99577022-99577044 CCCAGGCCTCCAGCCAGCTGTGG - Intronic
1122811444 14:104291360-104291382 CCCAGGTCTACAGATCTCCAGGG - Intergenic
1126882329 15:53112474-53112496 GCCAGGTCTCCAGAACTCTAGGG - Intergenic
1127635600 15:60866592-60866614 CCCCACTCTCCAGACCTCTAGGG + Intronic
1128735538 15:70051817-70051839 GCCAGGTCTCCAGACTCCCAGGG - Intronic
1130656703 15:85796281-85796303 CCCAGATCTGCAGACATCTAAGG + Intergenic
1131470359 15:92691260-92691282 CCCAGCTCCCCAGACCCCTAAGG - Intronic
1132312164 15:100865126-100865148 CCCAAGTTTACAGACATCTGTGG + Intergenic
1132368319 15:101274575-101274597 CCGAGGTCTCCAGTCACCTGGGG + Exonic
1138270458 16:55692244-55692266 CCCAGGCCTCCAGACATGGGTGG - Intronic
1139683044 16:68580457-68580479 CCCAGGTCTGCAGTCTTCTTGGG - Intergenic
1139794187 16:69468951-69468973 CCCACGTCTCTTGACAACTATGG + Intergenic
1141098237 16:81178100-81178122 CCCAGAACTTCAGACATCTCTGG + Intergenic
1141148455 16:81548099-81548121 CTCAGCTCTACTGACATCTAAGG + Intronic
1142155636 16:88531794-88531816 CCCAGGGCTCCTGGGATCTACGG + Intronic
1147299322 17:39511609-39511631 CCCACAGCTCCAAACATCTATGG - Exonic
1147765438 17:42832822-42832844 CCCAGATCTCCTAACTTCTACGG - Intronic
1149065250 17:52471675-52471697 CACTGGTTTCCAGACATATAAGG - Intergenic
1149555711 17:57571954-57571976 CCTAGTTCTCCAGACCCCTAAGG + Intronic
1153490840 18:5646523-5646545 CACAGACCTCCAGAAATCTAAGG + Intergenic
1155508259 18:26551048-26551070 CCCAGGTCTCCCCACCTCTGCGG + Intronic
1160695940 19:484621-484643 CCCAGCTGTGCAGACATCTACGG + Intergenic
1161812584 19:6479171-6479193 CCCAGGGATCCAGACATTCAGGG - Intronic
1163005460 19:14394425-14394447 CCCCTGTCTCCAGGCATCTCAGG + Intronic
1163476878 19:17531820-17531842 GCCTGGCCTCCAGACATCTCTGG + Intronic
1164159886 19:22619533-22619555 CCTAGGTCTCCAGGCAGCTCGGG - Intergenic
1164558991 19:29275597-29275619 CCCAGGTCTTCAGGCATAAAGGG + Intergenic
1164617347 19:29674983-29675005 CCCAGGTCTCCAGACATCTAGGG + Exonic
1166367880 19:42286405-42286427 CCCAAGGCCCCAGACCTCTACGG - Intronic
1168382982 19:55939886-55939908 TCCAGGTGTCCAGAGGTCTAGGG + Intergenic
925921347 2:8639903-8639925 CCCATGTCTGCACACAGCTAAGG + Intergenic
926057932 2:9786898-9786920 CCCAGGTCCCCAGTCATCCAGGG + Intergenic
928843574 2:35641169-35641191 CACAGTTCTTCAGACATATAGGG - Intergenic
930486853 2:52021605-52021627 CCCAGGGCTCAAGGCAGCTAAGG + Intergenic
932216062 2:69966526-69966548 CACAGGTCTCCAGACAGCTTTGG + Intergenic
932580807 2:72991623-72991645 CCCTGGTCTGCAGCCATCTTGGG - Intronic
934041467 2:88130677-88130699 CCCAGGTCCCTAGACATCCTAGG + Intergenic
937939307 2:127272811-127272833 CCCAGGTCCCCAGAGTGCTAGGG + Intronic
940150254 2:150592227-150592249 ACCATGTCTCCAGACATTTTTGG - Intergenic
946122168 2:217525667-217525689 GCCAGGACTCCAGACCTCAAAGG - Intronic
946286757 2:218710035-218710057 CTCAGGTCTACGGACATCTGAGG + Intergenic
946622257 2:221572907-221572929 CCCCGCTCTCCAGGCATCTGGGG - Intronic
948891823 2:240910561-240910583 CCCAGGACTCCAGACAGCCTTGG + Intergenic
1172150397 20:32786451-32786473 CCCAGGCCTCCAGTCACCTAAGG + Intronic
1172157321 20:32837010-32837032 CACAGGGCTACAGACACCTAAGG - Intronic
1174552323 20:51370862-51370884 CCCACGTCTCTCCACATCTATGG - Intergenic
1174951782 20:55050377-55050399 CCCAGGACTCCAGGGAGCTATGG - Intergenic
1175899803 20:62355495-62355517 TCCAGGACTCCAGACATCCCAGG + Intronic
1176923348 21:14716566-14716588 CACAAGGCTTCAGACATCTATGG + Intergenic
1178895322 21:36552999-36553021 CCCAGGTTTCCCGCCACCTAGGG + Intronic
1180916732 22:19494103-19494125 CCCAGCTCTCCAGACACCATGGG - Intronic
1181368239 22:22396702-22396724 CCCAGGCCGCCAGAAATCCATGG - Intergenic
1183487726 22:38098256-38098278 CCCAAGTCTCCAAACTTCCAGGG - Intronic
1185155081 22:49188639-49188661 CCCAGGTCTCCGGGCAGCTGTGG - Intergenic
1185231209 22:49685169-49685191 CCCAGGTCTCTAGACAGGGATGG + Intergenic
951111876 3:18813281-18813303 CCTAAGGCTCCAGACATGTAGGG + Intergenic
952745763 3:36777000-36777022 CCCAGATCTCTAGAGATCTCTGG + Intergenic
953231442 3:41068712-41068734 CCCATCTCCCCAGACTTCTATGG - Intergenic
953844824 3:46418883-46418905 CCCAAGTCTCCAGCCATGTCTGG + Intergenic
954713259 3:52515183-52515205 GCCAGCCCTCCAGACCTCTATGG - Intronic
954754103 3:52829718-52829740 CCAAAGTCTCCAGAAATCAAAGG - Intronic
959002305 3:100978561-100978583 CCCAGGGCTCCAGCTAGCTATGG + Intronic
959884586 3:111484626-111484648 CCCTGCTCTCAAGACATTTAAGG + Intronic
960182366 3:114595626-114595648 CCCAGGTTTCCAGATATCCAAGG - Intronic
961006221 3:123407016-123407038 CCCAGACCTGCAGACATCTTTGG + Intronic
964132912 3:153311214-153311236 GCCAGGTCTGCAGCCATCTCAGG - Intergenic
965849613 3:173008336-173008358 GCCAGGACTCCAGAGATCTGGGG + Intronic
967890726 3:194362622-194362644 CCCAGGTCTCCAGACCCCTGAGG + Intronic
969423769 4:7111983-7112005 CCCAGGTCTCCTGACCCCCAGGG + Intergenic
970585472 4:17510819-17510841 CCCAGGTCTTCAGAGATGCATGG - Intronic
972354786 4:38270048-38270070 CCCAGGACTCCACACTTCTCTGG + Intergenic
975984480 4:80189846-80189868 GTCAGTTCTCCAGACTTCTAAGG + Intronic
976305979 4:83559967-83559989 CCCAGGCATCCAGACATCACTGG - Intronic
980683526 4:136195071-136195093 AACAGGTCTCCAGATATCTAGGG + Intergenic
985822279 5:2168511-2168533 CCCAGGACTCCATGCATCTTAGG + Intergenic
986820785 5:11464491-11464513 AACAGGGCTCCAGACAACTAGGG + Intronic
993102844 5:83562721-83562743 CACAGGTCTCCAGTCATGAAGGG - Intronic
998321339 5:141235396-141235418 CCCACGTCTCCAGAGATGTACGG + Intergenic
999307580 5:150530123-150530145 CCCAGCTATCCAGGCACCTATGG - Intronic
1001241120 5:170070531-170070553 CCCAGGTCCCCAGCCTTCTGGGG + Intronic
1001821462 5:174713549-174713571 CCCAGGATTCCAGATTTCTATGG + Intergenic
1002409403 5:179061748-179061770 CGAAGGACTCCAGACATCCATGG + Intronic
1003359710 6:5413077-5413099 CCCACTTCACTAGACATCTAAGG - Intronic
1004064130 6:12226328-12226350 CCCAGGGATCCAGGGATCTAGGG - Intergenic
1004233222 6:13851347-13851369 ACCAGGTACCCAGACAACTAGGG + Intergenic
1007321720 6:41032792-41032814 CCCAGATCTCCAGATGTCCAGGG + Intronic
1010763628 6:79753296-79753318 AGCAGCTCCCCAGACATCTAGGG + Intergenic
1012177450 6:96106108-96106130 CCCAGAACTCCAGAACTCTAGGG - Intronic
1014290899 6:119557291-119557313 CTCAGTTCTCCAGACATACACGG - Intergenic
1014648094 6:124000603-124000625 CCCAGGTTTCTAGACGTATAGGG - Intronic
1017967104 6:159276303-159276325 CCCAGGTCCCCAGTCACCCATGG + Intergenic
1020021513 7:4872231-4872253 GCCATGTCTGCAGACATCTTTGG + Intronic
1023772127 7:43567441-43567463 GCCAGGTCTCCTGATTTCTATGG + Intergenic
1024200034 7:47097203-47097225 CCCAGGTCTCCAGTATTCTAAGG + Intergenic
1026463786 7:70636471-70636493 CGCAGGTCTCCTGATACCTACGG - Intronic
1032162051 7:129518441-129518463 CTCAGGTCTGCAGACACCTTGGG - Intergenic
1034879991 7:154756201-154756223 CCCAGGCCTCTGGACATCTCAGG - Intronic
1038420613 8:27431781-27431803 CCCAGGTCCCCTGACTTCCAAGG - Intronic
1038741332 8:30219555-30219577 CCCGGGTCAGCAGACATCTGAGG + Intergenic
1039884781 8:41648673-41648695 CCCAGGTCTCCAGGAAACCAGGG + Intronic
1047872610 8:129101577-129101599 CCCAGGTTTCCACACATTTTTGG + Intergenic
1053472663 9:38358012-38358034 CCCAAGTCTCCAGGTTTCTATGG + Intergenic
1055480566 9:76705334-76705356 CTCAGGTCTCAACACATCCACGG - Exonic
1055834269 9:80419878-80419900 CCCAGGGATCCACACTTCTATGG - Intergenic
1057122231 9:92586705-92586727 CTTTGATCTCCAGACATCTAAGG + Intronic
1061493931 9:130961108-130961130 CCAGGGTCCCCAGACATCAAGGG + Intergenic
1187798957 X:23038370-23038392 CACAGGTCTTCAGATATCCAGGG - Intergenic
1192339853 X:70254988-70255010 CCCAGGTCTCCTGACTCCCAGGG - Intergenic
1198024770 X:132694351-132694373 CCCAGCCCTGCAGATATCTAGGG + Intronic
1198094775 X:133368386-133368408 CCCAGGACTCCAAACATCCACGG + Intronic