ID: 1164624015

View in Genome Browser
Species Human (GRCh38)
Location 19:29714969-29714991
Sequence TGTCCACCCCGGCACCGGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 82}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164624006_1164624015 20 Left 1164624006 19:29714926-29714948 CCATGCCTCAGTTTCTCCATAGG 0: 1
1: 1
2: 32
3: 224
4: 1077
Right 1164624015 19:29714969-29714991 TGTCCACCCCGGCACCGGGAGGG 0: 1
1: 0
2: 1
3: 4
4: 82
1164624009_1164624015 15 Left 1164624009 19:29714931-29714953 CCTCAGTTTCTCCATAGGGACAA 0: 1
1: 0
2: 10
3: 95
4: 771
Right 1164624015 19:29714969-29714991 TGTCCACCCCGGCACCGGGAGGG 0: 1
1: 0
2: 1
3: 4
4: 82
1164624010_1164624015 4 Left 1164624010 19:29714942-29714964 CCATAGGGACAATGACTACACTA 0: 1
1: 0
2: 0
3: 11
4: 83
Right 1164624015 19:29714969-29714991 TGTCCACCCCGGCACCGGGAGGG 0: 1
1: 0
2: 1
3: 4
4: 82
1164624005_1164624015 25 Left 1164624005 19:29714921-29714943 CCTCTCCATGCCTCAGTTTCTCC 0: 5
1: 31
2: 201
3: 1065
4: 3668
Right 1164624015 19:29714969-29714991 TGTCCACCCCGGCACCGGGAGGG 0: 1
1: 0
2: 1
3: 4
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164624015 Original CRISPR TGTCCACCCCGGCACCGGGA GGG Exonic
902481084 1:16712262-16712284 GGTCCTCCCAGGCACAGGGAAGG - Intergenic
916077028 1:161207195-161207217 TGTTCACCCCGACACTGGGCTGG - Intronic
919813996 1:201426409-201426431 TGGCCTCCCCAGCCCCGGGAGGG - Intronic
920177146 1:204109042-204109064 AGCCCATCCGGGCACCGGGAGGG - Intronic
923724655 1:236495587-236495609 TGTCTACCCCGGGAGTGGGAGGG - Intergenic
1062977403 10:1694953-1694975 GCTCCACGCCTGCACCGGGAGGG + Intronic
1065227245 10:23556711-23556733 TGCCCACCACGGCACTAGGAAGG + Intergenic
1066557297 10:36628298-36628320 AGGCCAGCCCGGCACCGTGAAGG - Intergenic
1069903344 10:71718407-71718429 TTTCCAGCCAGGCACTGGGAGGG - Intronic
1070802831 10:79253654-79253676 TGTCCACCAGGGCACTGGCAAGG + Intronic
1074146299 10:110720312-110720334 TGTCCACCCGGCCACCAGCAGGG + Intronic
1074480451 10:113815526-113815548 TGTCCACAATGGCACCTGGAAGG - Intergenic
1076632546 10:131859726-131859748 TGTCCACCAGGTCACTGGGAGGG - Intergenic
1083257575 11:61506060-61506082 TCTCCACCCCGGCACCAGCCTGG - Intergenic
1083280625 11:61625033-61625055 TTTCCACCCCTACACCTGGAAGG + Intergenic
1085525639 11:77161944-77161966 TGTCCTCCTCTGCACCTGGAGGG + Intronic
1087422306 11:97945162-97945184 TGTCCACCCAGGGACCTGGAAGG - Intergenic
1091176394 11:133562114-133562136 TGTCAACCCAGGCACTGGGACGG + Intergenic
1096214643 12:49792465-49792487 TGCCCACCCCGACAACTGGAGGG - Exonic
1113802513 13:113093954-113093976 TCTCCACCGCGGCACCTGCATGG + Intronic
1121341714 14:93109084-93109106 TGTACACCCAGGCAAGGGGACGG + Intronic
1122921826 14:104883486-104883508 TGTCCACACCCGCACCCTGAAGG + Exonic
1123993784 15:25704034-25704056 CAGCCACCCGGGCACCGGGAGGG + Intronic
1128159877 15:65416637-65416659 TGTCCACCCCGGCACTGAGAGGG - Intronic
1133319314 16:4903178-4903200 TCTCCACCCCGGCAAGGGCAGGG - Intronic
1137036788 16:35575071-35575093 TGCCCTCCACAGCACCGGGATGG - Intergenic
1137695109 16:50456347-50456369 TGTCCACATGGGCACCTGGATGG - Intergenic
1139842552 16:69893180-69893202 TGTCCACCAGGGATCCGGGAGGG - Intronic
1141068479 16:80932582-80932604 TTTCCACCTCGGCACGAGGAGGG - Intergenic
1142676871 17:1519026-1519048 TGTCCACCCTTGCCCCAGGAGGG + Exonic
1143223535 17:5281948-5281970 TCTCCACCCCAGCACAGTGAGGG - Intergenic
1144080761 17:11761783-11761805 TGTCCCCTCCTGCACAGGGAAGG - Intronic
1146464039 17:33072166-33072188 TTTCCAGCCCTGCACAGGGAGGG - Intronic
1147900130 17:43778563-43778585 CGTGCACCCCGCCACGGGGAAGG + Intronic
1152779168 17:82218844-82218866 TGCCCACCCCAGCGCCTGGATGG - Intergenic
1152807281 17:82362118-82362140 TGTCCACCCCGGCAGTAGGCAGG + Exonic
1162954738 19:14091438-14091460 CGTCCAGCCCGGGACCGAGAGGG - Intergenic
1164624015 19:29714969-29714991 TGTCCACCCCGGCACCGGGAGGG + Exonic
1165388322 19:35524627-35524649 TGTCCAAACAGACACCGGGAAGG + Intronic
1166369776 19:42294297-42294319 TGCCCACCACGGCACCTGTACGG - Exonic
1202715123 1_KI270714v1_random:38166-38188 GGTCCTCCCAGGCACAGGGAAGG - Intergenic
927183943 2:20468697-20468719 TGTTCTCCCCAGCACCTGGAAGG - Intergenic
928364336 2:30689871-30689893 TCCCCACCCCGTCACCAGGAGGG - Intergenic
940330230 2:152466239-152466261 TGTCCTCCCCCGCAGCGGGCAGG - Intronic
948534036 2:238632846-238632868 TGTCCACCCAGACGCCGGGGAGG + Intergenic
1175082064 20:56429065-56429087 TGTCCACCCCGGCCTAGAGAGGG + Intronic
1175521283 20:59604168-59604190 CGCCCACCCCGGCACCGGAGGGG - Intronic
1176429014 21:6564788-6564810 TGTCCGCGCCGGCACCGGGGCGG + Intergenic
1179516095 21:41908019-41908041 TTTCCACTCCGGCACAGGGCCGG - Intronic
1179704503 21:43173104-43173126 TGTCCGCGCCGGCACCGGGGCGG + Intergenic
1180139120 21:45880666-45880688 GGGCCACCCTGGCACCGAGAGGG - Intronic
1180190355 21:46159948-46159970 TGGCCACGCCGGCACTGGGCTGG - Intergenic
1183665871 22:39245319-39245341 TTTCCACCCTGGCACAGGCATGG + Intergenic
1184261792 22:43321605-43321627 TGTCCACCCAGCCACAGCGAGGG + Intronic
1184337573 22:43862657-43862679 TGTCAGCCCCGGCAGCGGGTGGG - Intergenic
952262677 3:31755583-31755605 TGTCCACCCTTGCCCCTGGAAGG + Intronic
952287414 3:31981664-31981686 TATCCACCTCGGGACCTGGAGGG + Intronic
961627274 3:128272778-128272800 TGTCCACCCCTGGAGCTGGAAGG + Intronic
969085470 4:4653033-4653055 TGTCCACCCTGGCCCCCTGAGGG + Intergenic
969312619 4:6362739-6362761 TGTTCACCCCAGCACCAGGCAGG + Intronic
973531855 4:51843401-51843423 CGCCCGCCCCGGCCCCGGGAGGG - Intronic
979801346 4:124913388-124913410 TGTCCTCCCAGGGACCTGGAGGG - Intergenic
980550619 4:134328992-134329014 TCTCCACCCAGGCACCAGCAGGG - Intergenic
1000245046 5:159442148-159442170 TCCCCACCCCGGAACGGGGAGGG - Intergenic
1001052019 5:168421273-168421295 TGCCCACCCGGCCACAGGGAAGG + Intronic
1001228665 5:169967120-169967142 TGTCCACCTCTGGACCAGGAAGG - Intronic
1007085369 6:39140684-39140706 TCTCCACCCAGGCACTGGCAGGG + Intergenic
1016357589 6:143234973-143234995 TCTCCACCCCCGCCCCAGGAAGG - Intronic
1019153163 6:170022590-170022612 TGACCACCCCGCCAGAGGGACGG - Intergenic
1019437010 7:1027746-1027768 CCTCTACCCCGGCACAGGGAGGG + Intronic
1019485924 7:1289164-1289186 TGCCCACCCTGGCTCCGGGTGGG - Intergenic
1019547678 7:1586328-1586350 TCTCCTCCCCGGCACAGGCAGGG + Intergenic
1020003801 7:4771095-4771117 GCTGCACCCCAGCACCGGGAGGG + Exonic
1020181013 7:5922498-5922520 TGTCCACCCTGGGGCCTGGATGG - Intronic
1020301920 7:6802390-6802412 TGTCCACCCTGGGGCCTGGATGG + Intronic
1024580395 7:50796205-50796227 TGCCCACCCCTGCAAGGGGAAGG + Intergenic
1031990306 7:128193041-128193063 TGTCCTCCCAGGCACCGCAAGGG + Intergenic
1034954907 7:155328081-155328103 TGCCCACCCCGTCTCTGGGAAGG - Intergenic
1035568213 8:655952-655974 TGTCCACCTGGGCAGGGGGAGGG - Intronic
1049257422 8:141621346-141621368 TGTCCACCCAGGCTCCTGCAGGG + Intergenic
1062538171 9:137029986-137030008 TGGGCAGCCCGGCACAGGGAGGG + Intronic
1187187267 X:16998801-16998823 CCTCCACTCCTGCACCGGGAAGG + Intronic
1192332742 X:70190845-70190867 TGTCCACCCAGGAACCTGGCAGG + Intronic
1197083067 X:122441419-122441441 TGTCTACCCCAGCACCAGGTTGG - Intergenic
1197769839 X:130082897-130082919 TGCCCACCCCGGCACTGCCAAGG - Intronic
1197822838 X:130558973-130558995 TCTCCACCCTGGCACTGGTACGG + Intergenic
1200148919 X:153942021-153942043 TGTCCATCCCTCTACCGGGAAGG + Exonic
1200759902 Y:7028116-7028138 TGTCCATCACTGCACCTGGAAGG - Intronic