ID: 1164624386

View in Genome Browser
Species Human (GRCh38)
Location 19:29716490-29716512
Sequence TGGAAAAGGGTCCGTCCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164624386_1164624393 30 Left 1164624386 19:29716490-29716512 CCCAGAGGACGGACCCTTTTCCA No data
Right 1164624393 19:29716543-29716565 TACCAAGCTTCCCCAGGCCTTGG No data
1164624386_1164624392 24 Left 1164624386 19:29716490-29716512 CCCAGAGGACGGACCCTTTTCCA No data
Right 1164624392 19:29716537-29716559 TCTTAATACCAAGCTTCCCCAGG No data
1164624386_1164624390 -8 Left 1164624386 19:29716490-29716512 CCCAGAGGACGGACCCTTTTCCA No data
Right 1164624390 19:29716505-29716527 CTTTTCCATTTTTAAAAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164624386 Original CRISPR TGGAAAAGGGTCCGTCCTCT GGG (reversed) Intergenic
No off target data available for this crispr