ID: 1164624793

View in Genome Browser
Species Human (GRCh38)
Location 19:29719034-29719056
Sequence CCTCAGCCTCCCGAGTAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 747776
Summary {0: 993, 1: 105910, 2: 293918, 3: 225450, 4: 121505}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164624793_1164624800 6 Left 1164624793 19:29719034-29719056 CCCACCTACTCGGGAGGCTGAGG 0: 993
1: 105910
2: 293918
3: 225450
4: 121505
Right 1164624800 19:29719063-29719085 AGTCTCTTGAACTCGGGAGGTGG 0: 4
1: 115
2: 3413
3: 34856
4: 104375
1164624793_1164624798 0 Left 1164624793 19:29719034-29719056 CCCACCTACTCGGGAGGCTGAGG 0: 993
1: 105910
2: 293918
3: 225450
4: 121505
Right 1164624798 19:29719057-29719079 CAGAAGAGTCTCTTGAACTCGGG No data
1164624793_1164624797 -1 Left 1164624793 19:29719034-29719056 CCCACCTACTCGGGAGGCTGAGG 0: 993
1: 105910
2: 293918
3: 225450
4: 121505
Right 1164624797 19:29719056-29719078 GCAGAAGAGTCTCTTGAACTCGG No data
1164624793_1164624799 3 Left 1164624793 19:29719034-29719056 CCCACCTACTCGGGAGGCTGAGG 0: 993
1: 105910
2: 293918
3: 225450
4: 121505
Right 1164624799 19:29719060-29719082 AAGAGTCTCTTGAACTCGGGAGG No data
1164624793_1164624801 9 Left 1164624793 19:29719034-29719056 CCCACCTACTCGGGAGGCTGAGG 0: 993
1: 105910
2: 293918
3: 225450
4: 121505
Right 1164624801 19:29719066-29719088 CTCTTGAACTCGGGAGGTGGAGG 0: 25
1: 1284
2: 15264
3: 63859
4: 125260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164624793 Original CRISPR CCTCAGCCTCCCGAGTAGGT GGG (reversed) Intergenic
Too many off-targets to display for this crispr