ID: 1164624795

View in Genome Browser
Species Human (GRCh38)
Location 19:29719035-29719057
Sequence GCCTCAGCCTCCCGAGTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 718277
Summary {0: 911, 1: 100187, 2: 265964, 3: 218395, 4: 132820}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164624795_1164624797 -2 Left 1164624795 19:29719035-29719057 CCACCTACTCGGGAGGCTGAGGC 0: 911
1: 100187
2: 265964
3: 218395
4: 132820
Right 1164624797 19:29719056-29719078 GCAGAAGAGTCTCTTGAACTCGG No data
1164624795_1164624801 8 Left 1164624795 19:29719035-29719057 CCACCTACTCGGGAGGCTGAGGC 0: 911
1: 100187
2: 265964
3: 218395
4: 132820
Right 1164624801 19:29719066-29719088 CTCTTGAACTCGGGAGGTGGAGG 0: 25
1: 1284
2: 15264
3: 63859
4: 125260
1164624795_1164624798 -1 Left 1164624795 19:29719035-29719057 CCACCTACTCGGGAGGCTGAGGC 0: 911
1: 100187
2: 265964
3: 218395
4: 132820
Right 1164624798 19:29719057-29719079 CAGAAGAGTCTCTTGAACTCGGG No data
1164624795_1164624800 5 Left 1164624795 19:29719035-29719057 CCACCTACTCGGGAGGCTGAGGC 0: 911
1: 100187
2: 265964
3: 218395
4: 132820
Right 1164624800 19:29719063-29719085 AGTCTCTTGAACTCGGGAGGTGG 0: 4
1: 115
2: 3413
3: 34856
4: 104375
1164624795_1164624799 2 Left 1164624795 19:29719035-29719057 CCACCTACTCGGGAGGCTGAGGC 0: 911
1: 100187
2: 265964
3: 218395
4: 132820
Right 1164624799 19:29719060-29719082 AAGAGTCTCTTGAACTCGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164624795 Original CRISPR GCCTCAGCCTCCCGAGTAGG TGG (reversed) Intergenic
Too many off-targets to display for this crispr