ID: 1164624796

View in Genome Browser
Species Human (GRCh38)
Location 19:29719038-29719060
Sequence TCTGCCTCAGCCTCCCGAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 10991
Summary {0: 69, 1: 1193, 2: 3067, 3: 3213, 4: 3449}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164624796_1164624800 2 Left 1164624796 19:29719038-29719060 CCTACTCGGGAGGCTGAGGCAGA 0: 69
1: 1193
2: 3067
3: 3213
4: 3449
Right 1164624800 19:29719063-29719085 AGTCTCTTGAACTCGGGAGGTGG 0: 4
1: 115
2: 3413
3: 34856
4: 104375
1164624796_1164624799 -1 Left 1164624796 19:29719038-29719060 CCTACTCGGGAGGCTGAGGCAGA 0: 69
1: 1193
2: 3067
3: 3213
4: 3449
Right 1164624799 19:29719060-29719082 AAGAGTCTCTTGAACTCGGGAGG No data
1164624796_1164624797 -5 Left 1164624796 19:29719038-29719060 CCTACTCGGGAGGCTGAGGCAGA 0: 69
1: 1193
2: 3067
3: 3213
4: 3449
Right 1164624797 19:29719056-29719078 GCAGAAGAGTCTCTTGAACTCGG No data
1164624796_1164624798 -4 Left 1164624796 19:29719038-29719060 CCTACTCGGGAGGCTGAGGCAGA 0: 69
1: 1193
2: 3067
3: 3213
4: 3449
Right 1164624798 19:29719057-29719079 CAGAAGAGTCTCTTGAACTCGGG No data
1164624796_1164624801 5 Left 1164624796 19:29719038-29719060 CCTACTCGGGAGGCTGAGGCAGA 0: 69
1: 1193
2: 3067
3: 3213
4: 3449
Right 1164624801 19:29719066-29719088 CTCTTGAACTCGGGAGGTGGAGG 0: 25
1: 1284
2: 15264
3: 63859
4: 125260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164624796 Original CRISPR TCTGCCTCAGCCTCCCGAGT AGG (reversed) Intergenic
Too many off-targets to display for this crispr