ID: 1164624797

View in Genome Browser
Species Human (GRCh38)
Location 19:29719056-29719078
Sequence GCAGAAGAGTCTCTTGAACT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164624793_1164624797 -1 Left 1164624793 19:29719034-29719056 CCCACCTACTCGGGAGGCTGAGG 0: 993
1: 105910
2: 293918
3: 225450
4: 121505
Right 1164624797 19:29719056-29719078 GCAGAAGAGTCTCTTGAACTCGG No data
1164624791_1164624797 7 Left 1164624791 19:29719026-29719048 CCTGTAATCCCACCTACTCGGGA 0: 447
1: 47905
2: 213943
3: 256010
4: 187384
Right 1164624797 19:29719056-29719078 GCAGAAGAGTCTCTTGAACTCGG No data
1164624796_1164624797 -5 Left 1164624796 19:29719038-29719060 CCTACTCGGGAGGCTGAGGCAGA 0: 69
1: 1193
2: 3067
3: 3213
4: 3449
Right 1164624797 19:29719056-29719078 GCAGAAGAGTCTCTTGAACTCGG No data
1164624795_1164624797 -2 Left 1164624795 19:29719035-29719057 CCACCTACTCGGGAGGCTGAGGC 0: 911
1: 100187
2: 265964
3: 218395
4: 132820
Right 1164624797 19:29719056-29719078 GCAGAAGAGTCTCTTGAACTCGG No data
1164624788_1164624797 26 Left 1164624788 19:29719007-29719029 CCGGGCATGGAGGCACATGCCTG 0: 30
1: 5259
2: 25365
3: 71079
4: 139768
Right 1164624797 19:29719056-29719078 GCAGAAGAGTCTCTTGAACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164624797 Original CRISPR GCAGAAGAGTCTCTTGAACT CGG Intergenic
No off target data available for this crispr