ID: 1164625190

View in Genome Browser
Species Human (GRCh38)
Location 19:29723223-29723245
Sequence CCACCGTGTCTCCATGTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164625185_1164625190 19 Left 1164625185 19:29723181-29723203 CCACAGCAATCTAGCATCATCAG No data
Right 1164625190 19:29723223-29723245 CCACCGTGTCTCCATGTTCCTGG No data
1164625187_1164625190 -7 Left 1164625187 19:29723207-29723229 CCACCTTCACGTGTAGCCACCGT No data
Right 1164625190 19:29723223-29723245 CCACCGTGTCTCCATGTTCCTGG No data
1164625186_1164625190 -6 Left 1164625186 19:29723206-29723228 CCCACCTTCACGTGTAGCCACCG No data
Right 1164625190 19:29723223-29723245 CCACCGTGTCTCCATGTTCCTGG No data
1164625184_1164625190 20 Left 1164625184 19:29723180-29723202 CCCACAGCAATCTAGCATCATCA No data
Right 1164625190 19:29723223-29723245 CCACCGTGTCTCCATGTTCCTGG No data
1164625188_1164625190 -10 Left 1164625188 19:29723210-29723232 CCTTCACGTGTAGCCACCGTGTC No data
Right 1164625190 19:29723223-29723245 CCACCGTGTCTCCATGTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164625190 Original CRISPR CCACCGTGTCTCCATGTTCC TGG Intergenic
No off target data available for this crispr