ID: 1164625197

View in Genome Browser
Species Human (GRCh38)
Location 19:29723258-29723280
Sequence GCAGTTCCAGACTCTGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164625197_1164625206 17 Left 1164625197 19:29723258-29723280 CCAGGCTCAGAGTCTGGAACTGC No data
Right 1164625206 19:29723298-29723320 CTGGGCCCTGCAAAGAACCGAGG No data
1164625197_1164625204 -2 Left 1164625197 19:29723258-29723280 CCAGGCTCAGAGTCTGGAACTGC No data
Right 1164625204 19:29723279-29723301 GCTGATGGAGGGGCGGGTTCTGG No data
1164625197_1164625203 -8 Left 1164625197 19:29723258-29723280 CCAGGCTCAGAGTCTGGAACTGC No data
Right 1164625203 19:29723273-29723295 GGAACTGCTGATGGAGGGGCGGG No data
1164625197_1164625205 -1 Left 1164625197 19:29723258-29723280 CCAGGCTCAGAGTCTGGAACTGC No data
Right 1164625205 19:29723280-29723302 CTGATGGAGGGGCGGGTTCTGGG No data
1164625197_1164625202 -9 Left 1164625197 19:29723258-29723280 CCAGGCTCAGAGTCTGGAACTGC No data
Right 1164625202 19:29723272-29723294 TGGAACTGCTGATGGAGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164625197 Original CRISPR GCAGTTCCAGACTCTGAGCC TGG (reversed) Intergenic
No off target data available for this crispr