ID: 1164628867

View in Genome Browser
Species Human (GRCh38)
Location 19:29747830-29747852
Sequence CTGAGGGCAGAGATTGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164628863_1164628867 -1 Left 1164628863 19:29747808-29747830 CCTCTGGGACATGGAGCCTACTC No data
Right 1164628867 19:29747830-29747852 CTGAGGGCAGAGATTGAGCATGG No data
1164628857_1164628867 26 Left 1164628857 19:29747781-29747803 CCGGCCTGCACGTGGGACACGGA No data
Right 1164628867 19:29747830-29747852 CTGAGGGCAGAGATTGAGCATGG No data
1164628862_1164628867 2 Left 1164628862 19:29747805-29747827 CCTCCTCTGGGACATGGAGCCTA No data
Right 1164628867 19:29747830-29747852 CTGAGGGCAGAGATTGAGCATGG No data
1164628858_1164628867 22 Left 1164628858 19:29747785-29747807 CCTGCACGTGGGACACGGAACCT No data
Right 1164628867 19:29747830-29747852 CTGAGGGCAGAGATTGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164628867 Original CRISPR CTGAGGGCAGAGATTGAGCA TGG Intergenic
No off target data available for this crispr