ID: 1164630264

View in Genome Browser
Species Human (GRCh38)
Location 19:29757513-29757535
Sequence GACCACTTAGAGATGGCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164630260_1164630264 1 Left 1164630260 19:29757489-29757511 CCAGGGGCATCAGTAAAGACAGG No data
Right 1164630264 19:29757513-29757535 GACCACTTAGAGATGGCCCAGGG No data
1164630256_1164630264 23 Left 1164630256 19:29757467-29757489 CCTGGGGGACGTGCTGAAGGAGC No data
Right 1164630264 19:29757513-29757535 GACCACTTAGAGATGGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164630264 Original CRISPR GACCACTTAGAGATGGCCCA GGG Intergenic
No off target data available for this crispr