ID: 1164630412

View in Genome Browser
Species Human (GRCh38)
Location 19:29758146-29758168
Sequence TGCGGTGTCCTCCCACATAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164630409_1164630412 -8 Left 1164630409 19:29758131-29758153 CCTGGACACGCAGCCTGCGGTGT No data
Right 1164630412 19:29758146-29758168 TGCGGTGTCCTCCCACATAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164630412 Original CRISPR TGCGGTGTCCTCCCACATAA GGG Intergenic
No off target data available for this crispr