ID: 1164635808

View in Genome Browser
Species Human (GRCh38)
Location 19:29790805-29790827
Sequence TAAAATCAACTTGGCAAATC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164635808_1164635812 30 Left 1164635808 19:29790805-29790827 CCGGATTTGCCAAGTTGATTTTA No data
Right 1164635812 19:29790858-29790880 TACCATGCCCTGCCACATTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164635808 Original CRISPR TAAAATCAACTTGGCAAATC CGG (reversed) Intergenic
No off target data available for this crispr