ID: 1164635808 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 19:29790805-29790827 |
| Sequence | TAAAATCAACTTGGCAAATC CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1164635808_1164635812 | 30 | Left | 1164635808 | 19:29790805-29790827 | CCGGATTTGCCAAGTTGATTTTA | No data | ||
| Right | 1164635812 | 19:29790858-29790880 | TACCATGCCCTGCCACATTCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1164635808 | Original CRISPR | TAAAATCAACTTGGCAAATC CGG (reversed) | Intergenic | ||