ID: 1164635809 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 19:29790814-29790836 |
| Sequence | AGTTTGGAATAAAATCAACT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1164635809_1164635814 | 27 | Left | 1164635809 | 19:29790814-29790836 | CCAAGTTGATTTTATTCCAAACT | No data | ||
| Right | 1164635814 | 19:29790864-29790886 | GCCCTGCCACATTCCGGCCCTGG | No data | ||||
| 1164635809_1164635812 | 21 | Left | 1164635809 | 19:29790814-29790836 | CCAAGTTGATTTTATTCCAAACT | No data | ||
| Right | 1164635812 | 19:29790858-29790880 | TACCATGCCCTGCCACATTCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1164635809 | Original CRISPR | AGTTTGGAATAAAATCAACT TGG (reversed) | Intergenic | ||