ID: 1164635810

View in Genome Browser
Species Human (GRCh38)
Location 19:29790830-29790852
Sequence TGGCTAGATTCAGTGCAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164635810_1164635812 5 Left 1164635810 19:29790830-29790852 CCAAACTGCACTGAATCTAGCCA No data
Right 1164635812 19:29790858-29790880 TACCATGCCCTGCCACATTCCGG No data
1164635810_1164635814 11 Left 1164635810 19:29790830-29790852 CCAAACTGCACTGAATCTAGCCA No data
Right 1164635814 19:29790864-29790886 GCCCTGCCACATTCCGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164635810 Original CRISPR TGGCTAGATTCAGTGCAGTT TGG (reversed) Intergenic
No off target data available for this crispr