ID: 1164635812

View in Genome Browser
Species Human (GRCh38)
Location 19:29790858-29790880
Sequence TACCATGCCCTGCCACATTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164635810_1164635812 5 Left 1164635810 19:29790830-29790852 CCAAACTGCACTGAATCTAGCCA No data
Right 1164635812 19:29790858-29790880 TACCATGCCCTGCCACATTCCGG No data
1164635809_1164635812 21 Left 1164635809 19:29790814-29790836 CCAAGTTGATTTTATTCCAAACT No data
Right 1164635812 19:29790858-29790880 TACCATGCCCTGCCACATTCCGG No data
1164635808_1164635812 30 Left 1164635808 19:29790805-29790827 CCGGATTTGCCAAGTTGATTTTA No data
Right 1164635812 19:29790858-29790880 TACCATGCCCTGCCACATTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164635812 Original CRISPR TACCATGCCCTGCCACATTC CGG Intergenic
No off target data available for this crispr