ID: 1164635814

View in Genome Browser
Species Human (GRCh38)
Location 19:29790864-29790886
Sequence GCCCTGCCACATTCCGGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164635809_1164635814 27 Left 1164635809 19:29790814-29790836 CCAAGTTGATTTTATTCCAAACT No data
Right 1164635814 19:29790864-29790886 GCCCTGCCACATTCCGGCCCTGG No data
1164635810_1164635814 11 Left 1164635810 19:29790830-29790852 CCAAACTGCACTGAATCTAGCCA No data
Right 1164635814 19:29790864-29790886 GCCCTGCCACATTCCGGCCCTGG No data
1164635811_1164635814 -9 Left 1164635811 19:29790850-29790872 CCACTTTGTACCATGCCCTGCCA No data
Right 1164635814 19:29790864-29790886 GCCCTGCCACATTCCGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164635814 Original CRISPR GCCCTGCCACATTCCGGCCC TGG Intergenic
No off target data available for this crispr