ID: 1164635822

View in Genome Browser
Species Human (GRCh38)
Location 19:29790892-29790914
Sequence TCCTCCCCCTGCATGACTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164635817_1164635822 -1 Left 1164635817 19:29790870-29790892 CCACATTCCGGCCCTGGCACCAT No data
Right 1164635822 19:29790892-29790914 TCCTCCCCCTGCATGACTGTAGG No data
1164635818_1164635822 -8 Left 1164635818 19:29790877-29790899 CCGGCCCTGGCACCATCCTCCCC No data
Right 1164635822 19:29790892-29790914 TCCTCCCCCTGCATGACTGTAGG No data
1164635813_1164635822 9 Left 1164635813 19:29790860-29790882 CCATGCCCTGCCACATTCCGGCC No data
Right 1164635822 19:29790892-29790914 TCCTCCCCCTGCATGACTGTAGG No data
1164635811_1164635822 19 Left 1164635811 19:29790850-29790872 CCACTTTGTACCATGCCCTGCCA No data
Right 1164635822 19:29790892-29790914 TCCTCCCCCTGCATGACTGTAGG No data
1164635815_1164635822 4 Left 1164635815 19:29790865-29790887 CCCTGCCACATTCCGGCCCTGGC No data
Right 1164635822 19:29790892-29790914 TCCTCCCCCTGCATGACTGTAGG No data
1164635816_1164635822 3 Left 1164635816 19:29790866-29790888 CCTGCCACATTCCGGCCCTGGCA No data
Right 1164635822 19:29790892-29790914 TCCTCCCCCTGCATGACTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164635822 Original CRISPR TCCTCCCCCTGCATGACTGT AGG Intergenic
No off target data available for this crispr