ID: 1164636097

View in Genome Browser
Species Human (GRCh38)
Location 19:29792496-29792518
Sequence GGGTGTGCCTCCATTCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164636095_1164636097 -8 Left 1164636095 19:29792481-29792503 CCAAATTGCAGCTTGGGGTGTGC No data
Right 1164636097 19:29792496-29792518 GGGTGTGCCTCCATTCCAGGAGG No data
1164636089_1164636097 1 Left 1164636089 19:29792472-29792494 CCGGAGACCCCAAATTGCAGCTT No data
Right 1164636097 19:29792496-29792518 GGGTGTGCCTCCATTCCAGGAGG No data
1164636087_1164636097 23 Left 1164636087 19:29792450-29792472 CCTGCACACTGAACTCTGCTTTC No data
Right 1164636097 19:29792496-29792518 GGGTGTGCCTCCATTCCAGGAGG No data
1164636094_1164636097 -7 Left 1164636094 19:29792480-29792502 CCCAAATTGCAGCTTGGGGTGTG No data
Right 1164636097 19:29792496-29792518 GGGTGTGCCTCCATTCCAGGAGG No data
1164636093_1164636097 -6 Left 1164636093 19:29792479-29792501 CCCCAAATTGCAGCTTGGGGTGT No data
Right 1164636097 19:29792496-29792518 GGGTGTGCCTCCATTCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164636097 Original CRISPR GGGTGTGCCTCCATTCCAGG AGG Intergenic