ID: 1164636129

View in Genome Browser
Species Human (GRCh38)
Location 19:29792691-29792713
Sequence ATGGAAAAGCGTTCCTCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164636118_1164636129 28 Left 1164636118 19:29792640-29792662 CCAGCTGAGCCCTGGGAAGGACG No data
Right 1164636129 19:29792691-29792713 ATGGAAAAGCGTTCCTCCCAGGG No data
1164636125_1164636129 -4 Left 1164636125 19:29792672-29792694 CCAAGTTTTTTTCCTGTCTATGG No data
Right 1164636129 19:29792691-29792713 ATGGAAAAGCGTTCCTCCCAGGG No data
1164636123_1164636129 -2 Left 1164636123 19:29792670-29792692 CCCCAAGTTTTTTTCCTGTCTAT No data
Right 1164636129 19:29792691-29792713 ATGGAAAAGCGTTCCTCCCAGGG No data
1164636122_1164636129 18 Left 1164636122 19:29792650-29792672 CCTGGGAAGGACGGCTAGGACCC No data
Right 1164636129 19:29792691-29792713 ATGGAAAAGCGTTCCTCCCAGGG No data
1164636124_1164636129 -3 Left 1164636124 19:29792671-29792693 CCCAAGTTTTTTTCCTGTCTATG No data
Right 1164636129 19:29792691-29792713 ATGGAAAAGCGTTCCTCCCAGGG No data
1164636121_1164636129 19 Left 1164636121 19:29792649-29792671 CCCTGGGAAGGACGGCTAGGACC No data
Right 1164636129 19:29792691-29792713 ATGGAAAAGCGTTCCTCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164636129 Original CRISPR ATGGAAAAGCGTTCCTCCCA GGG Intergenic
No off target data available for this crispr