ID: 1164639578

View in Genome Browser
Species Human (GRCh38)
Location 19:29813939-29813961
Sequence GCTTCTCTGCTAACCTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 114}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164639578_1164639587 28 Left 1164639578 19:29813939-29813961 CCCAGCTAGGTTAGCAGAGAAGC 0: 1
1: 0
2: 1
3: 10
4: 114
Right 1164639587 19:29813990-29814012 TAGTTCATCTGGAAGCGTGAAGG 0: 1
1: 0
2: 0
3: 5
4: 58
1164639578_1164639584 5 Left 1164639578 19:29813939-29813961 CCCAGCTAGGTTAGCAGAGAAGC 0: 1
1: 0
2: 1
3: 10
4: 114
Right 1164639584 19:29813967-29813989 ACTTTGCAGAGCAGCAGCCAGGG 0: 1
1: 0
2: 2
3: 32
4: 281
1164639578_1164639588 29 Left 1164639578 19:29813939-29813961 CCCAGCTAGGTTAGCAGAGAAGC 0: 1
1: 0
2: 1
3: 10
4: 114
Right 1164639588 19:29813991-29814013 AGTTCATCTGGAAGCGTGAAGGG 0: 1
1: 0
2: 0
3: 5
4: 113
1164639578_1164639585 17 Left 1164639578 19:29813939-29813961 CCCAGCTAGGTTAGCAGAGAAGC 0: 1
1: 0
2: 1
3: 10
4: 114
Right 1164639585 19:29813979-29814001 AGCAGCCAGGGTAGTTCATCTGG 0: 1
1: 0
2: 0
3: 8
4: 126
1164639578_1164639583 4 Left 1164639578 19:29813939-29813961 CCCAGCTAGGTTAGCAGAGAAGC 0: 1
1: 0
2: 1
3: 10
4: 114
Right 1164639583 19:29813966-29813988 CACTTTGCAGAGCAGCAGCCAGG 0: 1
1: 0
2: 3
3: 36
4: 320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164639578 Original CRISPR GCTTCTCTGCTAACCTAGCT GGG (reversed) Intronic
900498347 1:2987121-2987143 GCTTCTCTGCCTCCCTGGCTTGG - Intergenic
907488828 1:54795791-54795813 GCTTCTCTCCCCACTTAGCTGGG - Intronic
922220339 1:223553419-223553441 GCAGCTCAGCTAACCTGGCTTGG - Intronic
922765113 1:228152497-228152519 GCCTGTCTGCAAACCTGGCTGGG - Intronic
924926628 1:248690327-248690349 GCTTCTTTATTAGCCTAGCTTGG - Intergenic
1063402411 10:5759025-5759047 GTTTCTCTGCTACCCCAGCAGGG - Intronic
1066276088 10:33870288-33870310 CCTTCTCTGAGAACCTACCTTGG - Intergenic
1069296444 10:66851082-66851104 CCTTCACTGATAACCTGGCTTGG + Intronic
1069823649 10:71242367-71242389 TCCTCTCTGCTGAACTAGCTCGG - Intronic
1069985122 10:72277724-72277746 GCATCTCAGCTGAGCTAGCTTGG - Intergenic
1070116749 10:73536168-73536190 GCTTAGCTCGTAACCTAGCTTGG - Intronic
1070502994 10:77089106-77089128 GCTCCTGTGCTAACATAGCCTGG + Intronic
1072517182 10:96196510-96196532 CCTTCCCTGGTAACCTACCTTGG + Intronic
1072895760 10:99365214-99365236 GCTTCTCTGCTCACATGGTTGGG + Intronic
1077629895 11:3804265-3804287 GCTTCCCTGTTCATCTAGCTTGG - Intronic
1081747335 11:45482413-45482435 GTTTCTCTGCTCACCAGGCTAGG - Intergenic
1083539320 11:63501320-63501342 GAATCTCTGTTAACATAGCTAGG + Intergenic
1088121865 11:106379432-106379454 GCTCCTCTGCTCACCTCACTGGG + Intergenic
1088806947 11:113361077-113361099 GCTGCTCTGCTCAGCAAGCTGGG - Intronic
1089279058 11:117359846-117359868 GCTTCTCTGCACACCTAGTCAGG + Intronic
1090135827 11:124198577-124198599 GCTTCTCTGCTAGAGGAGCTTGG - Intergenic
1091436310 12:475793-475815 GCTTCTCTAGCAACCTAGCTGGG - Intronic
1091605591 12:1948920-1948942 GCTTCTGTGCTCAGTTAGCTAGG - Intronic
1092025116 12:5233314-5233336 GCATCTCTGCGAACGTGGCTCGG - Intergenic
1095962044 12:47841757-47841779 CCTTCTCTGTTGACCTCGCTTGG + Intronic
1101450830 12:104777363-104777385 GCTTCTCTGTGACCCTAGCTGGG - Intergenic
1102716682 12:114979751-114979773 GCTTCTGTGCCCAGCTAGCTAGG + Intergenic
1102907913 12:116691303-116691325 GCTTCTCTGATAACCTATATTGG + Intergenic
1110986936 13:81983118-81983140 GCTTTTCTGCAATCCTAGATAGG + Intergenic
1116274332 14:42811130-42811152 GCTTTTCTGCTGACCTGGCAGGG - Intergenic
1118642376 14:67804687-67804709 GTTTCTCTGGTAACTTAGCCTGG - Intronic
1122258457 14:100498237-100498259 GCTTCTCTGCAAATCTGGCGCGG + Intronic
1124928531 15:34096516-34096538 GCTTCTCTGCTACCCTGGAGTGG - Intronic
1125278908 15:38024084-38024106 GCTTTTCTGCTTTCCAAGCTTGG + Intergenic
1128565507 15:68698271-68698293 GCTCATCTGTTATCCTAGCTGGG - Intronic
1128782965 15:70375076-70375098 TGTTCACTGCTCACCTAGCTTGG + Intergenic
1129760781 15:78128258-78128280 GCTCCTTTGCTAACCTAGTCTGG - Intronic
1131446647 15:92503819-92503841 GCTTCTCTGATAAACTCGTTAGG - Intergenic
1132307836 15:100830515-100830537 GCTCCTCTGCGAACCTAACAGGG + Intergenic
1135195968 16:20394880-20394902 GCTTCTCTGCAGACCCACCTGGG + Intronic
1139367335 16:66441580-66441602 GCTACTCTTCTAACCTGGCAGGG - Intronic
1143665681 17:8358024-8358046 GTTTCTCAGCTAACCAAGCATGG - Intergenic
1144673186 17:17144415-17144437 GTTTCTCTGTTAACTTAGCTGGG + Intronic
1146669199 17:34725123-34725145 CCTTCTCTGCTCACCCAGCCTGG - Intergenic
1147792891 17:43024634-43024656 GCTTCTCTGCTAGTCTAGGCCGG + Intronic
1148228149 17:45913822-45913844 GCTTCTCTGCTGCCCTGGCCGGG + Intronic
1148643645 17:49206543-49206565 GGGTCTCTGCTGACCTTGCTGGG - Exonic
1149439589 17:56663443-56663465 GCTTCAGTGCTGACCCAGCTGGG + Intergenic
1149967379 17:61179125-61179147 CCTTCTCTACTAATCTACCTGGG - Intronic
1152496404 17:80675666-80675688 GCTGCTCTGCTCACCGGGCTCGG + Intronic
1153982194 18:10320101-10320123 GCCTCTCTGCTAACCTTGGAAGG - Intergenic
1164639578 19:29813939-29813961 GCTTCTCTGCTAACCTAGCTGGG - Intronic
1164691448 19:30213727-30213749 GTTTCTGTTCTAACCTACCTGGG - Intergenic
1164878181 19:31707789-31707811 TCTTCCCTGCTACACTAGCTGGG - Intergenic
1166418270 19:42612011-42612033 GAATCTCTGTTAACATAGCTAGG + Intronic
1168288127 19:55344552-55344574 TCTTCTCTGAAAACCGAGCTGGG + Intronic
930872616 2:56184147-56184169 GCTTCTCCCCTCTCCTAGCTTGG - Exonic
932272072 2:70419521-70419543 GCTACTCTGGGCACCTAGCTGGG + Intergenic
932272136 2:70419804-70419826 GCTACTCTGGGCACCTAGCTGGG + Intergenic
932272157 2:70419896-70419918 GCTACTCTGGGCACCTAGCTGGG + Intergenic
932272201 2:70420085-70420107 GCTACTCTGGGCACCTAGCTGGG + Intergenic
932288669 2:70556702-70556724 GCTTCTCTGCTATACTGCCTCGG + Intergenic
932468505 2:71939150-71939172 GTTACTCTGCTACCCTTGCTTGG + Intergenic
932598060 2:73106565-73106587 GCTTCTCTGCTGACCTGGAAGGG - Intronic
935339830 2:102049919-102049941 GCTGCTCTGTTAACCCAGCAAGG + Intergenic
940594227 2:155769081-155769103 GATTTTCTGCTAATCTGGCTGGG + Intergenic
941783207 2:169471552-169471574 GCTTCTCTGCTATCCAGGCTAGG + Intergenic
943307464 2:186281491-186281513 TCTTCTTTGTTAATCTAGCTAGG + Intergenic
945055454 2:205864981-205865003 GCATCTCTGCTCATCTAGCTTGG - Intergenic
946572205 2:221036478-221036500 GGTTTTCTGCTAGTCTAGCTAGG + Intergenic
948567768 2:238897451-238897473 GCTGCTCTGCCACCCTTGCTGGG - Intronic
948703832 2:239777443-239777465 GCTTCTCTCCTCACCTCGCATGG - Intronic
948979153 2:241484005-241484027 GCTTCTCAGCCAAGCTAGCTGGG + Intronic
1172094062 20:32452172-32452194 GCTGCTCTGCAGACCCAGCTGGG + Intronic
1175230559 20:57470989-57471011 GCTTCTCTTCTGCCCTAGATGGG - Intergenic
1178119382 21:29452504-29452526 CCATCTCTGATAACCAAGCTGGG - Intronic
1182709264 22:32310461-32310483 GCCTGTCTGCTAGCCCAGCTGGG - Intergenic
950496505 3:13337250-13337272 CCCTCTCTCCTAATCTAGCTGGG + Intronic
951725058 3:25748460-25748482 GGTTTTATGCTAATCTAGCTAGG - Intronic
953045108 3:39288063-39288085 CATTCTCTGGGAACCTAGCTTGG + Intergenic
954501774 3:51024545-51024567 GCTTTTCTGCTGGCCTAGCAGGG - Intronic
955292954 3:57709331-57709353 GCTTCTCTTCTAACAGAGGTAGG - Intergenic
958502777 3:94936262-94936284 GCTTTTGTGCAAACCAAGCTTGG + Intergenic
965548452 3:169938994-169939016 GCTTCTCACCTTCCCTAGCTTGG - Exonic
966002520 3:174967769-174967791 GCTTCTCTGCTTATCTTTCTTGG - Intronic
966759149 3:183400897-183400919 CCTTCTCTTCTAACCTCTCTAGG + Intronic
967329724 3:188278334-188278356 CCTTTTCTGCTTACCTGGCTTGG + Intronic
970206511 4:13660770-13660792 ACTTCTCTGCTGACCTTTCTAGG + Intergenic
972943097 4:44221162-44221184 CCTTCTCTGCTAAACTAGACTGG + Intronic
995141602 5:108741488-108741510 CCTCCTCAGCTACCCTAGCTGGG + Intergenic
995551088 5:113282188-113282210 CCTTCTCTGCTAACTTCACTGGG - Intronic
1001556822 5:172642202-172642224 GCTTCTTTGCATACCGAGCTGGG - Intronic
1002123554 5:177023753-177023775 GCTTCTCTGCTAACCTTGTCAGG + Intronic
1002802745 6:541186-541208 GCTCCTCTGCTCCCTTAGCTTGG + Intronic
1006048887 6:31324632-31324654 TCTTCTTTACTAGCCTAGCTAGG - Intronic
1009753831 6:67909118-67909140 CCTTCTCAGCTAACATAGCAAGG + Intergenic
1012696638 6:102392079-102392101 GCTTTCCTGCTAACCTGGCGGGG + Intergenic
1013495140 6:110690367-110690389 GCTTCCCTGCTGACCTGGCAGGG + Intronic
1013553225 6:111230894-111230916 GCTTCTCTCCCAACCTACCCTGG + Intronic
1015701133 6:136037410-136037432 GGTTCTCGGCAAACCTATCTGGG - Intronic
1016100816 6:140097807-140097829 GTTTCTCTGCTGATCTTGCTTGG - Intergenic
1022175071 7:27864600-27864622 CTTTCTCTTCTAACCAAGCTGGG - Intronic
1023482182 7:40645796-40645818 GCTTCTCTGCCAATCAAGCTGGG + Intronic
1023705981 7:42942299-42942321 GCTTCTCTGATAGCCTAGCTTGG + Intronic
1027396237 7:77757625-77757647 TGGTCTCTGCTAACTTAGCTGGG + Intronic
1029708900 7:102289030-102289052 TCTTCCCTGCTCACCTGGCTGGG + Intronic
1031710900 7:125046057-125046079 CCTTCTGTGCTGACCTGGCTGGG - Intergenic
1033529900 7:142251313-142251335 GGTTCTCTTCTTCCCTAGCTGGG + Intergenic
1034009483 7:147513473-147513495 GGTTCTCTACTCACCTCGCTGGG + Intronic
1037800130 8:22028665-22028687 GCTTCTCTGCTAGAATAGTTAGG + Intronic
1037909043 8:22732871-22732893 GCTTCTCTGGCAAGCTAGCCTGG + Intronic
1040455602 8:47594404-47594426 CCTTCTCTGGTATCCCAGCTGGG + Intronic
1041256398 8:55982958-55982980 TCTTCTCTCCTCCCCTAGCTTGG + Intronic
1042847074 8:73179006-73179028 GCTTCGCGGCTAAGCGAGCTAGG + Intergenic
1048582432 8:135740883-135740905 GCTTCTCTGCTTGGCTAGCTTGG + Intergenic
1052460061 9:28751405-28751427 GTTTCAATGCAAACCTAGCTGGG - Intergenic
1056832403 9:89927861-89927883 GCTTCGCTGCAACACTAGCTAGG - Intergenic
1057035595 9:91809817-91809839 GGGTCACTGCTAACCTTGCTGGG + Intronic
1059222844 9:112642000-112642022 GCTTTTCTGCTTGCGTAGCTTGG + Intronic
1185763268 X:2704592-2704614 CCATCTCTGCTAAATTAGCTGGG - Intronic
1185953223 X:4459603-4459625 GCTTCAATGCTGACCTAGTTTGG + Intergenic
1191175730 X:57499444-57499466 TTTTCTTTGTTAACCTAGCTAGG - Intergenic
1193556662 X:82961742-82961764 GCTTTCCTGCTGACCTAGCAGGG + Intergenic
1194876297 X:99192595-99192617 GCTTCTCTGCTAGGTTGGCTAGG - Intergenic
1197010420 X:121555086-121555108 CCTTCTCTGATGATCTAGCTAGG - Intergenic
1199656608 X:150002075-150002097 CCCTCTCTGCTAACCTGTCTTGG + Intergenic