ID: 1164639579

View in Genome Browser
Species Human (GRCh38)
Location 19:29813940-29813962
Sequence GGCTTCTCTGCTAACCTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 91}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164639579_1164639588 28 Left 1164639579 19:29813940-29813962 CCAGCTAGGTTAGCAGAGAAGCC 0: 1
1: 0
2: 0
3: 9
4: 91
Right 1164639588 19:29813991-29814013 AGTTCATCTGGAAGCGTGAAGGG 0: 1
1: 0
2: 0
3: 5
4: 113
1164639579_1164639587 27 Left 1164639579 19:29813940-29813962 CCAGCTAGGTTAGCAGAGAAGCC 0: 1
1: 0
2: 0
3: 9
4: 91
Right 1164639587 19:29813990-29814012 TAGTTCATCTGGAAGCGTGAAGG 0: 1
1: 0
2: 0
3: 5
4: 58
1164639579_1164639583 3 Left 1164639579 19:29813940-29813962 CCAGCTAGGTTAGCAGAGAAGCC 0: 1
1: 0
2: 0
3: 9
4: 91
Right 1164639583 19:29813966-29813988 CACTTTGCAGAGCAGCAGCCAGG 0: 1
1: 0
2: 3
3: 36
4: 320
1164639579_1164639584 4 Left 1164639579 19:29813940-29813962 CCAGCTAGGTTAGCAGAGAAGCC 0: 1
1: 0
2: 0
3: 9
4: 91
Right 1164639584 19:29813967-29813989 ACTTTGCAGAGCAGCAGCCAGGG 0: 1
1: 0
2: 2
3: 32
4: 281
1164639579_1164639585 16 Left 1164639579 19:29813940-29813962 CCAGCTAGGTTAGCAGAGAAGCC 0: 1
1: 0
2: 0
3: 9
4: 91
Right 1164639585 19:29813979-29814001 AGCAGCCAGGGTAGTTCATCTGG 0: 1
1: 0
2: 0
3: 8
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164639579 Original CRISPR GGCTTCTCTGCTAACCTAGC TGG (reversed) Intronic
900152619 1:1185258-1185280 AGCGTCTCTGCTCACTTAGCTGG + Intronic
903061024 1:20668935-20668957 AGTTTCTCTGTTAACTTAGCTGG + Intronic
905386028 1:37604926-37604948 GGCTTCTCTGCTCTCCCAGACGG - Intergenic
907281342 1:53349250-53349272 GGCTTCTCTGCACTCCTAGGGGG - Intergenic
907488829 1:54795792-54795814 GGCTTCTCTCCCCACTTAGCTGG - Intronic
912194552 1:107382087-107382109 GGCTTCTCTGTTCTCCTTGCTGG + Intronic
912593492 1:110851025-110851047 GGCTTCTCTGCTGCCCTTGAAGG + Intergenic
913251477 1:116915306-116915328 GGCATCTCTGCAACCCTAGCAGG + Intronic
920600859 1:207322101-207322123 GGCTGCTCCGCAAACCCAGCCGG - Intronic
921441878 1:215197376-215197398 GGCCTCTCTGCTAGGCTTGCGGG + Intronic
1063402412 10:5759026-5759048 CGTTTCTCTGCTACCCCAGCAGG - Intronic
1065159674 10:22906934-22906956 GGCTTCTCTACTAATATTGCTGG + Intergenic
1070950518 10:80427425-80427447 GGCTTCTCTGGAAACCTGGAAGG + Exonic
1080600106 11:33814021-33814043 GTATTCTGTGCAAACCTAGCAGG + Intergenic
1081685719 11:45041739-45041761 AGCCGCTCTGCTAACCTGGCAGG - Intergenic
1081899829 11:46618066-46618088 GGATTCTCTGCCAAACAAGCAGG - Intronic
1083629662 11:64089092-64089114 GGCTCCTCTGTGAACCCAGCCGG + Intronic
1087283711 11:96241616-96241638 GGCTTCTCTGTCAACATAACAGG + Intronic
1091436311 12:475794-475816 GGCTTCTCTAGCAACCTAGCTGG - Intronic
1092036502 12:5339926-5339948 TGCCTCTCTGTTAACCTGGCAGG - Intergenic
1096997954 12:55851100-55851122 GGCTTTGCTGCTAGCATAGCAGG + Intergenic
1101450831 12:104777364-104777386 GGCTTCTCTGTGACCCTAGCTGG - Intergenic
1105473831 13:20714553-20714575 GGCTCCTCTGCCAACTGAGCTGG - Intronic
1106873336 13:34045102-34045124 GGCTTCTCTCCTTAGCTTGCAGG - Intergenic
1113032462 13:106009452-106009474 AGCTTCACGGCTAACTTAGCAGG - Intergenic
1115403532 14:32990895-32990917 GGCATCTCTGTTACCCAAGCTGG - Intronic
1116274333 14:42811131-42811153 AGCTTTTCTGCTGACCTGGCAGG - Intergenic
1117185554 14:53236801-53236823 GGCTTCTCTGCTACAATAGGTGG + Intergenic
1121742767 14:96265794-96265816 GTCTTCTCTGCTAACCTGAGAGG - Intronic
1130882960 15:88070709-88070731 GGCTTCCCTGCAGACCTAGGTGG - Intronic
1131543947 15:93299909-93299931 GGCTTCTCTGCAAATTTGGCTGG - Intergenic
1132307835 15:100830514-100830536 TGCTCCTCTGCGAACCTAACAGG + Intergenic
1132931745 16:2462287-2462309 GGCTGCTCTGCAAACCTGCCAGG - Intronic
1138085163 16:54126843-54126865 GGCATCTCTGCCATCCTTGCAGG - Intergenic
1139367336 16:66441581-66441603 GGCTACTCTTCTAACCTGGCAGG - Intronic
1139476732 16:67206594-67206616 GGCTTCTCTGCCTCCCCAGCTGG + Intergenic
1142786959 17:2231854-2231876 GGCTTCTCTGCAAAGCTAAATGG + Intronic
1143038063 17:4011833-4011855 TGCTTCTCTGAAAACCCAGCTGG - Intronic
1143376053 17:6468380-6468402 GGCTTCTCTGCTTCCCTCCCAGG + Intronic
1144673185 17:17144414-17144436 TGTTTCTCTGTTAACTTAGCTGG + Intronic
1148228148 17:45913821-45913843 GGCTTCTCTGCTGCCCTGGCCGG + Intronic
1148245701 17:46028759-46028781 GGCAGCTCTGCAAACCTAGCAGG - Intergenic
1151419142 17:73985881-73985903 GGCTACGCTGCTGGCCTAGCGGG + Intergenic
1152496414 17:80675702-80675724 GGCTGCTCTGCTCACCGGGCTGG + Intronic
1159117686 18:64134410-64134432 GACTTCTCTGCTTCCCTAGCTGG + Intergenic
1160982718 19:1823646-1823668 GACTTCTCTGCCAGCCTGGCGGG + Exonic
1164639579 19:29813940-29813962 GGCTTCTCTGCTAACCTAGCTGG - Intronic
1164687125 19:30174225-30174247 GGCTGCTCTGCTGAACTGGCTGG + Intergenic
925434829 2:3827705-3827727 AGCTTCTCTGATAATCTAGTTGG - Intronic
928910993 2:36420689-36420711 GCCTTCTCTGCTTCCCCAGCTGG - Intronic
932598061 2:73106566-73106588 GGCTTCTCTGCTGACCTGGAAGG - Intronic
933086264 2:78058347-78058369 GGCTTTTCTGCTGATCTGGCAGG - Intergenic
933964279 2:87422696-87422718 GGTGTCTTTGCTAACCTGGCTGG - Intergenic
942702272 2:178726222-178726244 GGGTTCTCTGCCCATCTAGCTGG - Intronic
945815538 2:214601132-214601154 GGCGTCATTGCTAAACTAGCAGG - Intergenic
948979152 2:241484004-241484026 AGCTTCTCAGCCAAGCTAGCTGG + Intronic
1172094061 20:32452171-32452193 GGCTGCTCTGCAGACCCAGCTGG + Intronic
1175230560 20:57470990-57471012 GGCTTCTCTTCTGCCCTAGATGG - Intergenic
951055582 3:18142950-18142972 GGCTACCCTGCTAAGGTAGCAGG - Intronic
954501775 3:51024546-51024568 AGCTTTTCTGCTGGCCTAGCAGG - Intronic
955525872 3:59819160-59819182 GGTTTCTTTGCTAACCCAGTAGG - Intronic
963494158 3:146039078-146039100 GGCTTCTCTGATAAGCCAACAGG + Intergenic
966170696 3:177076688-177076710 GGATTCTCTGATAACCAAGGTGG - Intronic
973715765 4:53674319-53674341 GGCTTCTCTCCTTACTAAGCAGG + Intronic
985124089 4:186674362-186674384 GGCTTCTCTGCTACCAAAGTTGG - Intronic
988647606 5:33111513-33111535 GGCTTCTCTGCTATGCAAGTTGG + Intergenic
992502664 5:77357555-77357577 AGCTTCTCTCCAAACCCAGCAGG + Intronic
995733375 5:115270681-115270703 GTCTTCTCTGCCAAACTGGCTGG - Intronic
1001889968 5:175330566-175330588 GGCCTCTTTGCTGACCCAGCAGG + Intergenic
1008000579 6:46355936-46355958 GCCTTCTCTACTAACCCAGCTGG + Intronic
1012696637 6:102392078-102392100 AGCTTTCCTGCTAACCTGGCGGG + Intergenic
1013495139 6:110690366-110690388 AGCTTCCCTGCTGACCTGGCAGG + Intronic
1014635326 6:123839114-123839136 GCCTTCTGTGCTAACCAAACAGG - Intronic
1014764549 6:125391825-125391847 GCCTTTTCTGCAAATCTAGCTGG + Intergenic
1015610546 6:135013043-135013065 GTCTTATCTACTAACCTAACTGG - Intronic
1017385076 6:153873933-153873955 GGCTTCTTTCCTAACATTGCTGG + Intergenic
1018603690 6:165575454-165575476 AGCTTCTCTCCTAACTCAGCTGG + Intronic
1018634155 6:165846279-165846301 GGCTTCTCTGGAAACTTGGCAGG - Intronic
1023482181 7:40645795-40645817 AGCTTCTCTGCCAATCAAGCTGG + Intronic
1027396236 7:77757624-77757646 GTGGTCTCTGCTAACTTAGCTGG + Intronic
1032778762 7:135144533-135144555 TGGTTCTCTGGCAACCTAGCTGG - Intronic
1033529899 7:142251312-142251334 GGGTTCTCTTCTTCCCTAGCTGG + Intergenic
1034009482 7:147513472-147513494 GGGTTCTCTACTCACCTCGCTGG + Intronic
1035395967 7:158534816-158534838 GTCGTCTCTGCTGATCTAGCAGG - Intronic
1036225257 8:6952717-6952739 AGTTTCTCTGTTAACTTAGCTGG + Intergenic
1040799563 8:51325674-51325696 GGCTTCCGTCCTAACCCAGCAGG - Intronic
1042856975 8:73277525-73277547 GGCTTCTCTGGAAACCTGGAAGG - Intergenic
1043517762 8:81011784-81011806 GCCTTCTCTGCAAAAGTAGCTGG - Intronic
1043859835 8:85303391-85303413 GTCTTCTCTGCTGAGCTTGCAGG - Intergenic
1045205937 8:100040629-100040651 GGCTTCTCTGCCAACAGTGCTGG + Intronic
1051463458 9:17350440-17350462 GTCTTCTCTGCTAAGCTATGAGG - Intronic
1055833481 9:80410635-80410657 GGCTTCTCTGGTAACTTTGGGGG - Intergenic
1058721485 9:107768531-107768553 GGCTTCTCTGGTCACCTGACCGG - Intergenic
1059834534 9:118136345-118136367 GGCATCACTGATAACCTTGCTGG + Intergenic
1060084282 9:120682615-120682637 GTCTTCTCTGCCACCCAAGCTGG + Intronic
1062133607 9:134913239-134913261 GGCTTCTGTGCGGACCGAGCAGG + Intronic
1186924978 X:14323542-14323564 CGCTGCTCTGCAAAACTAGCTGG - Intergenic
1188794875 X:34450499-34450521 TGCTTCTCTGGTAAACTACCTGG - Intergenic
1190049789 X:47141131-47141153 GGCTTCTCTTCAAACGTAGGAGG + Intergenic
1193556661 X:82961741-82961763 AGCTTTCCTGCTGACCTAGCAGG + Intergenic
1199501379 X:148510440-148510462 AGCTTCTCTGCTAATCTATAAGG + Intronic