ID: 1164639580

View in Genome Browser
Species Human (GRCh38)
Location 19:29813961-29813983
Sequence CTGCTGCTCTGCAAAGTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 1, 2: 1, 3: 39, 4: 289}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164639580_1164639585 -5 Left 1164639580 19:29813961-29813983 CCCCTCACTTTGCAGAGCAGCAG 0: 1
1: 1
2: 1
3: 39
4: 289
Right 1164639585 19:29813979-29814001 AGCAGCCAGGGTAGTTCATCTGG 0: 1
1: 0
2: 0
3: 8
4: 126
1164639580_1164639588 7 Left 1164639580 19:29813961-29813983 CCCCTCACTTTGCAGAGCAGCAG 0: 1
1: 1
2: 1
3: 39
4: 289
Right 1164639588 19:29813991-29814013 AGTTCATCTGGAAGCGTGAAGGG 0: 1
1: 0
2: 0
3: 5
4: 113
1164639580_1164639587 6 Left 1164639580 19:29813961-29813983 CCCCTCACTTTGCAGAGCAGCAG 0: 1
1: 1
2: 1
3: 39
4: 289
Right 1164639587 19:29813990-29814012 TAGTTCATCTGGAAGCGTGAAGG 0: 1
1: 0
2: 0
3: 5
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164639580 Original CRISPR CTGCTGCTCTGCAAAGTGAG GGG (reversed) Intronic
900078617 1:837850-837872 CTTCTGCAGTGCAAACTGAGAGG - Intergenic
900875241 1:5337883-5337905 TTCCTGATCTGCAAAATGAGGGG - Intergenic
901122463 1:6906741-6906763 CTGCTGCACTCGAAAATGAGGGG - Intronic
901252576 1:7791796-7791818 CTTCTGCTATGCAAAGAGACTGG - Intronic
901435525 1:9245209-9245231 CTTGTGCTCTGCACAGTGACTGG - Exonic
902330702 1:15729960-15729982 CTGCTGCTCTGCCATCTCAGGGG - Intronic
902907416 1:19568665-19568687 CTGCTGCTTGGCTAAGTGAGGGG - Intergenic
903445104 1:23418002-23418024 CTGGTTGTCTGCAAAGTGAGAGG + Exonic
904500758 1:30911548-30911570 CTGCTGCTCTTCAAAGACACTGG + Intergenic
904850636 1:33456546-33456568 CTGCTTGTATGCAAAGGGAGAGG + Intergenic
905948252 1:41921800-41921822 CAGCTTCTTTGGAAAGTGAGAGG + Intronic
906729169 1:48066453-48066475 CAGCTGCTGTGCAAAGTGCTGGG - Intergenic
906922089 1:50075569-50075591 AGGCTGCTCTGCACAGTGTGTGG + Intronic
906942353 1:50266193-50266215 CTCCTTATCTGGAAAGTGAGTGG + Intergenic
907236197 1:53050402-53050424 CTGCTGATCTGCAAAAAGTGTGG + Intronic
907765639 1:57408064-57408086 CTGCTCCTCTACAGAATGAGTGG + Intronic
910951565 1:92653702-92653724 CTGCTGCTCTGCATGGAGAGGGG - Intronic
911956485 1:104242270-104242292 GGGCTGCTCTGGAAAGTTAGGGG + Intergenic
912141636 1:106737175-106737197 CTGCTGCTCTGGATACTGGGTGG + Intergenic
915713633 1:157924554-157924576 CTGAACCTCTCCAAAGTGAGGGG + Intergenic
915853515 1:159354036-159354058 AGGCTTCTCTGAAAAGTGAGGGG + Intergenic
915932621 1:160069746-160069768 CTGCTGGTCTGCCCAGTGGGAGG + Intronic
916507507 1:165441364-165441386 CAGTTGCTCTGCAAAGCCAGGGG - Intronic
917414544 1:174795330-174795352 TTGCTGGTATGGAAAGTGAGTGG - Intronic
918140939 1:181719452-181719474 CTGCTGCTCTGACAAAGGAGTGG - Intronic
919371999 1:196739488-196739510 CTCCTGCTATGCAAAGAGACTGG - Intronic
921026420 1:211287230-211287252 CTCCTGCTCTGCAGAGGGAGGGG - Intronic
922610373 1:226922480-226922502 CTGTTGCTATGCAAAGTGGCTGG + Intronic
923994862 1:239482400-239482422 CTTCTACTCTGCAAAGTCACAGG + Intronic
1063153980 10:3361517-3361539 CTGTTGCTATGCAAAGAGACTGG + Intergenic
1064012195 10:11743535-11743557 CTGCTGCTCTGCAAGGGGCTGGG + Intronic
1064682898 10:17829093-17829115 CTGCTGCCCTGCAAAGGGACTGG + Intronic
1068913147 10:62400169-62400191 CCACTGCTCTCCAAAGTGCGAGG + Intronic
1070698185 10:78578587-78578609 CTGCTGCCTTGCAGAATGAGTGG - Intergenic
1070809621 10:79291056-79291078 CTGCTGCCCCGCAAACTGTGGGG - Exonic
1074405510 10:113177419-113177441 CTGCTGCTCGGACAAGTGGGGGG + Intergenic
1074452939 10:113574143-113574165 CTCCAGCTCTGCACAGTGAGGGG - Intronic
1075407734 10:122205698-122205720 GTGCTGCTCTGCAGAGGAAGGGG + Intronic
1075986806 10:126795072-126795094 CTGCTGCTCTGTCAGCTGAGAGG + Intergenic
1076102651 10:127795291-127795313 CTCCTACTCTGTAAAGTGGGGGG + Intergenic
1077970721 11:7187207-7187229 CTGCTGCTCTAGAAAGTAAGAGG + Intergenic
1078502613 11:11896612-11896634 CTGCTGCTGTGCTAAGTAATAGG + Intronic
1079315557 11:19405198-19405220 CATATGCTCTGCCAAGTGAGTGG + Intronic
1079349072 11:19677462-19677484 CTCCTCCTCTGTAAAATGAGGGG - Intronic
1079604512 11:22348066-22348088 TTCCTGCTCTGTAAAATGAGAGG - Intronic
1080485593 11:32704069-32704091 CTACGGCTCTGCAAAGTCAGTGG + Intronic
1081167180 11:39820784-39820806 CTCTTGCTATGCAAAGTGACTGG - Intergenic
1082868436 11:57920705-57920727 CTGCTGCTCTGCCACTGGAGTGG - Intergenic
1082940853 11:58703734-58703756 CTGCTGCTCTGTACAGGGAGAGG - Intronic
1083458370 11:62794314-62794336 CTGCTGCTCTGGAGAGAGGGTGG + Exonic
1084690449 11:70722211-70722233 CTGCTGCCCTGGCAAGAGAGTGG - Intronic
1084709134 11:70833213-70833235 CTGGTGCTGTGCACAGTCAGAGG - Intronic
1084750415 11:71201254-71201276 CTGAGGCACTGCAAAGAGAGAGG + Intronic
1085109255 11:73873250-73873272 CTCCTGCACTGCAAAGTGGGAGG + Exonic
1085128390 11:74017549-74017571 CTGAGGCTCTTCAAATTGAGTGG + Intronic
1085875676 11:80404109-80404131 CTGTTGCTATGCAAAGAGACTGG + Intergenic
1087119488 11:94558759-94558781 CTGCTGCTCTGCCTATGGAGTGG + Intronic
1087904286 11:103677520-103677542 ATGCAGCTTTGCACAGTGAGTGG - Intergenic
1088087242 11:105996145-105996167 CTGCTGCTCTGCCAAGTGGTAGG - Intronic
1090606996 11:128431981-128432003 TTTCTGCTCTGCACAATGAGTGG - Intergenic
1090969510 11:131628208-131628230 CTGATGCTTTGCAGAGTGTGTGG - Intronic
1091029750 11:132175073-132175095 CTGCTGCTTTGCAAATAAAGTGG + Intronic
1091069445 11:132549443-132549465 CTGCTGCTCTGCCAATGGAGTGG + Intronic
1091119317 11:133043476-133043498 CTGCTGTTCTCCAAAGTGTTAGG + Intronic
1091699396 12:2650252-2650274 CTCCTGTCCTGCATAGTGAGGGG + Intronic
1092359723 12:7826079-7826101 CTGCTGCTCTGGAAAGTCTCGGG + Intronic
1092372492 12:7928685-7928707 CTGCTGCTCTGGAAAGTCTCGGG + Intronic
1093245663 12:16732988-16733010 CTACTGGTCTGCAACCTGAGTGG - Intergenic
1093666044 12:21814359-21814381 CTACTGCTATTCAAAGTGGGTGG + Intronic
1095969573 12:47892349-47892371 CTGCTGCCCTTGAAAGTGAGTGG - Intronic
1096093495 12:48918945-48918967 CTGCCTCCCTGCAAAGTGAAAGG + Intronic
1099328199 12:81246275-81246297 CTGCAGCTCTGTAGAGAGAGGGG + Intronic
1099334073 12:81330963-81330985 CTCATGCTCTGCATAGTGAAAGG - Intronic
1102742710 12:115222487-115222509 CTGCTGGGATGCAATGTGAGAGG + Intergenic
1103232260 12:119341330-119341352 CAGCTGCTCTGCAGGGGGAGGGG + Intronic
1104230920 12:126883235-126883257 CAGCTGATCTCCAAAGGGAGAGG + Intergenic
1104333742 12:127872627-127872649 CTGCTTCGTTGCAAAGGGAGAGG - Intergenic
1104580242 12:130006221-130006243 CTGCTGCTCTGGACTGTGGGTGG + Intergenic
1104640535 12:130464154-130464176 CTGCTGCTCTGCCTATGGAGTGG + Intronic
1104789420 12:131472526-131472548 CTGGTCATCAGCAAAGTGAGGGG + Intergenic
1104979453 12:132567250-132567272 CTGCTGCTCTGAGCAGAGAGGGG + Intronic
1105708092 13:22981296-22981318 GTGCTGCTCTGAAAAGGGACAGG - Intergenic
1114352055 14:21863547-21863569 TTGCGGCTCTCCAAAGTGAGTGG + Intergenic
1114597767 14:23928347-23928369 GTCCTGCTCTCCAAAGTGGGAGG - Intergenic
1114803231 14:25803096-25803118 TTTCTCGTCTGCAAAGTGAGAGG - Intergenic
1115014796 14:28597495-28597517 CTGTTGCTCCAAAAAGTGAGGGG - Intergenic
1117498943 14:56332690-56332712 CTGCTGTCCTTAAAAGTGAGTGG + Intergenic
1118536576 14:66773091-66773113 CTGCCGCTGTGCAGACTGAGTGG + Intronic
1120340091 14:83208447-83208469 CTGCTGCTCTGAAATGAAAGAGG - Intergenic
1121080487 14:91103980-91104002 CTACTGCTCTGCAGAGTGGTGGG - Intronic
1122007950 14:98721234-98721256 TTGCTGCTTTGCAGAGTGAGAGG + Intergenic
1124515556 15:30364517-30364539 TTGTTGGTCTGTAAAGTGAGGGG - Intronic
1124727365 15:32166207-32166229 TTGTTGGTCTGTAAAGTGAGGGG + Intronic
1126238858 15:46417801-46417823 CTGCTCATCTGTAAAATGAGAGG + Intergenic
1126968483 15:54083407-54083429 CTGCTGCTCTGTGTAGGGAGAGG + Intronic
1129186291 15:73909024-73909046 ATCCTCGTCTGCAAAGTGAGGGG + Intergenic
1129875365 15:78971985-78972007 CTTCAGCTCTGCAAAGTTGGGGG - Intronic
1130362392 15:83202323-83202345 CTTATGCTTTACAAAGTGAGAGG + Intronic
1131076523 15:89498749-89498771 CTGCTTCTTTGCCAAGGGAGTGG - Intergenic
1132228848 15:100166851-100166873 CTGGTGCTCTGCAAAATGCCTGG - Intronic
1132615630 16:840009-840031 GTGCTGCCCTGCAGAGTGGGAGG + Intergenic
1133898413 16:9950539-9950561 GTAGGGCTCTGCAAAGTGAGAGG - Intronic
1137864677 16:51881013-51881035 CTGCTGCTCTCCAGAGAGATGGG + Intergenic
1139111403 16:63895546-63895568 TTGCTGCTCTGCAAAGGGAAGGG - Intergenic
1139715821 16:68812166-68812188 CTGCTGACCTTCAAGGTGAGGGG + Exonic
1139839707 16:69868416-69868438 CAGCTGCTCTGCAGAGGGACAGG + Intronic
1140650440 16:77082490-77082512 CTGCTGCTGTGGACAGTGTGTGG - Intergenic
1140842988 16:78859166-78859188 CTGCTTCTCTGCAAAGGTGGAGG - Intronic
1140843118 16:78860720-78860742 CTGCTGCACTGCAAAATGTGTGG + Intronic
1140995111 16:80251496-80251518 TTCCTGATCTGCAAAGAGAGAGG - Intergenic
1141146718 16:81536087-81536109 TGGCTGCTCTGCAAAGCCAGGGG - Intronic
1141248075 16:82329381-82329403 CTGCTGCCCTACAAAGGAAGAGG - Intergenic
1141475064 16:84267440-84267462 CTTCTGCTCTACAAATGGAGGGG + Intergenic
1142860108 17:2755967-2755989 CTGCGGCTCTCCAAAGAGATGGG + Intergenic
1146491943 17:33289756-33289778 CTATTGCTTTGCAAAGTGTGTGG - Intronic
1146708666 17:35021485-35021507 CTGCTGCTCAGGAAAGTCTGGGG + Exonic
1147302619 17:39541878-39541900 TTCCTGCTCTGTAAAGGGAGAGG - Intronic
1147527628 17:41240976-41240998 GTGCTCCTCTGGAAGGTGAGAGG - Intronic
1147587822 17:41662794-41662816 CTGCTGCTCCGCCAGGTGAGCGG - Intergenic
1147788074 17:42994568-42994590 CTTCTCCTCCCCAAAGTGAGGGG - Intergenic
1148067209 17:44880476-44880498 GTTCTGCTCCGAAAAGTGAGAGG + Intronic
1148626935 17:49076597-49076619 CTGCTGCTCTGCCTATGGAGTGG - Intergenic
1148955867 17:51353237-51353259 CTGCCACTATGCAAAGTGAATGG - Intergenic
1150321357 17:64217089-64217111 TTGCTCATCTGCAAAATGAGGGG + Intronic
1150676065 17:67246160-67246182 CCGCTGCGCTGGAAAGTGTGGGG + Intergenic
1152742688 17:82025226-82025248 CCTCTGCTCTGGGAAGTGAGGGG + Intronic
1153488596 18:5627155-5627177 CTGTTGCTGTTCAAAGTGCGAGG + Intronic
1156300555 18:35832697-35832719 CTACTGCTGTGCAGAGTAAGTGG + Intergenic
1159215485 18:65386418-65386440 CTGTTGCTATGCAAAGAGACTGG + Intergenic
1159494784 18:69188926-69188948 CTTCTGCTCTGCTATGTGAGGGG - Intergenic
1160946619 19:1646811-1646833 TTTCAGCTCTGAAAAGTGAGAGG + Intronic
1161791257 19:6361648-6361670 CCGCTGCGCTGGAAAGTGAGCGG - Exonic
1163457200 19:17414322-17414344 CTGCTGCAGTGAACAGTGAGTGG + Intronic
1163822401 19:19503362-19503384 CTGCCGCTGTCCTAAGTGAGGGG + Intronic
1164639580 19:29813961-29813983 CTGCTGCTCTGCAAAGTGAGGGG - Intronic
1165253599 19:34559287-34559309 CTGGTGCTCTGGGAAGTCAGGGG + Intergenic
1166076058 19:40414519-40414541 CTTCTGGTCTGCAAAGTGGAAGG - Intergenic
926657450 2:15424275-15424297 CTGCTGCTCAGTAATGTTAGTGG - Intronic
927979377 2:27364571-27364593 CTGATGATCTGCAATGTAAGCGG - Exonic
929873714 2:45778746-45778768 CTGCTGTTATGCAAATAGAGGGG - Intronic
930506084 2:52284249-52284271 CTGCTGCTGAGGAAAGTGAGGGG - Intergenic
931220950 2:60287269-60287291 CAGATGCCCTGCAAAGTGAGAGG + Intergenic
931672331 2:64658844-64658866 CTGCTGCTATACAAACTTAGGGG - Intronic
931881481 2:66575441-66575463 CTGTGGCTCTGCGAAGGGAGGGG - Intergenic
932089441 2:68791861-68791883 GTGCTGCCCTCTAAAGTGAGAGG - Intronic
932805505 2:74779269-74779291 TTGCTCATCTGGAAAGTGAGAGG + Intergenic
935497113 2:103794812-103794834 CTGTTGCTATGCAAAGAGACTGG - Intergenic
935685931 2:105682623-105682645 CCGCTGCTCAGCAGTGTGAGAGG + Intergenic
936116473 2:109706851-109706873 TTCCTGCTGTGGAAAGTGAGGGG - Intergenic
936718930 2:115225328-115225350 CTGCTGGGGTGCAACGTGAGAGG + Intronic
938592958 2:132757180-132757202 CTGATCCTGTGCAAAATGAGTGG + Intronic
938762295 2:134436814-134436836 CTGCTTGTCTGCAAAGAGTGAGG - Intronic
940352079 2:152702058-152702080 CTACTGCTGTGCAGAGTGAGTGG + Intronic
940484019 2:154274996-154275018 CTCTTGCTATGCAAAGAGAGTGG + Intronic
940696633 2:156986923-156986945 CTGCTTCTCTGCAAAATAAAGGG + Intergenic
942431673 2:175918185-175918207 CAGCTGCTGTGAAAAGTGAGAGG - Intergenic
943423255 2:187697244-187697266 CTGTTGCTATGCAAAGAGACTGG + Intergenic
943743155 2:191433194-191433216 TTTCTTCTCTGCAAAGTGAAGGG - Intergenic
945875240 2:215271635-215271657 CTGCTGCTTTGCATTGTGATGGG - Intergenic
948353796 2:237361249-237361271 GTGCTGCTCTGCCAAATGAAGGG - Intronic
948404643 2:237708062-237708084 TTTCTGCTCTGTAAAGCGAGGGG + Intronic
1169083737 20:2814692-2814714 CTGCAGCTCTGCAAACTCACAGG + Intergenic
1171108750 20:22460998-22461020 CTGCTGCTCTGCAAAGTACAAGG + Intergenic
1172478387 20:35255769-35255791 CTCCTCGTCTGCAAAGTGAGGGG + Intronic
1173254309 20:41383080-41383102 CTGCTGCTCTGTCCAGTGACAGG + Intergenic
1174188953 20:48726384-48726406 ATGCAGCTCTGCAAAGGGACAGG + Exonic
1175220016 20:57411524-57411546 CTGCCGCCCAGCCAAGTGAGCGG - Intergenic
1175770263 20:61619013-61619035 TTGCTGCTCTGGAAAGGAAGAGG - Intronic
1176037276 20:63045738-63045760 CTGCTGTTCTTTGAAGTGAGGGG + Intergenic
1176073090 20:63236795-63236817 CTGCTGTTCTGCACAGGGAGAGG + Intronic
1178437724 21:32574576-32574598 CTGCAGCTCTGCAATGTTTGGGG + Intergenic
1179334305 21:40435896-40435918 CTGCTGCTCAGCATCATGAGAGG - Intronic
1180082514 21:45493326-45493348 CTGCTGCTGTGACACGTGAGGGG + Intronic
1180625521 22:17191093-17191115 TGGCTGCTCTTTAAAGTGAGGGG + Intronic
1180671927 22:17560460-17560482 CTGCTGATATGCACAGGGAGTGG - Intergenic
1181785559 22:25224213-25224235 CTGAAGCTCTGCAAAGTGAAGGG - Intronic
1183339673 22:37273283-37273305 CTCCTGCTTTGAAAACTGAGTGG - Intergenic
1184054233 22:42033719-42033741 CTGCTGCTCTCAACAGAGAGGGG + Intronic
1184864174 22:47193181-47193203 GTTCTGCTCTGCAAAGGAAGTGG - Intergenic
949743493 3:7263289-7263311 CTGCTGCGCTGGAGAGGGAGAGG + Intronic
949893600 3:8752719-8752741 CTGCTGCCCTGGGCAGTGAGTGG - Exonic
950866836 3:16196376-16196398 TTCCTCCTCTGGAAAGTGAGTGG - Intronic
950973249 3:17211334-17211356 CTGGTGCTCTGGAAAGCAAGTGG + Intronic
952186408 3:30974151-30974173 CTGCTGTTCTCAAAACTGAGAGG - Intergenic
952219756 3:31313281-31313303 CTGCTGGACTACAATGTGAGAGG - Intergenic
952755371 3:36861040-36861062 CTGCTGACCCGCAAAGTAAGTGG - Exonic
953345286 3:42170470-42170492 CTGCTGCTATCAAAAGCGAGAGG + Intronic
956471050 3:69567173-69567195 TTGCTGCCGTGTAAAGTGAGTGG - Intergenic
956559972 3:70564740-70564762 CTGCTAGTCTGCATAGGGAGGGG + Intergenic
959050957 3:101524831-101524853 CTCCTGCTCTGCCATGTGAGTGG + Intergenic
960659186 3:120040238-120040260 CTACTGCTGTGCAGAGTGAGTGG + Intronic
960823693 3:121760496-121760518 CTGCTGCTCTGTGAATTGTGTGG + Intergenic
961175216 3:124829859-124829881 CTGCTGGTCTTAAAAGAGAGAGG - Intronic
961455112 3:127020196-127020218 CTGCAGCTCTGCAAAGGCTGTGG - Exonic
961832199 3:129628968-129628990 CAGCTACTCTGCAGACTGAGGGG - Intergenic
962133742 3:132710495-132710517 GTGCTGCTGTGCAAAGGGAGAGG + Intronic
962460939 3:135612188-135612210 CTCCTGCTATGCAAAGTGACTGG + Intergenic
962474204 3:135741341-135741363 CTGCTGCTCTGCAGAATGAATGG - Intergenic
962954291 3:140249880-140249902 CTGTTGCCCTGCGGAGTGAGGGG - Intronic
963091546 3:141487415-141487437 CTGCTGCTCTCCGGAGGGAGTGG + Intronic
963989150 3:151633416-151633438 CTGTTGCTCTGCAAAGCCAATGG - Intergenic
964895610 3:161591306-161591328 CTCCTGCTATGCAAAGAGACTGG - Intergenic
965760275 3:172068241-172068263 CTGATGCTCTGCCGAGTGAATGG + Intronic
966805329 3:183803269-183803291 CTGCTTTTCTGCAAAGTCTGTGG + Exonic
966837123 3:184057864-184057886 CTGCTGCTTTACAAGCTGAGTGG + Intronic
966985349 3:185175047-185175069 ATGCTGCTCTGCAATATTAGGGG + Intergenic
967685054 3:192409040-192409062 CAGCAGCACTGCAAAGAGAGCGG + Exonic
967766735 3:193289109-193289131 CTGGTGCTCTGTGGAGTGAGGGG + Intronic
968795670 4:2702499-2702521 CTCCTGCTCTGCTGACTGAGAGG - Intronic
968892118 4:3374964-3374986 CAGATGCTTTGCCAAGTGAGTGG + Intronic
969315572 4:6379769-6379791 CTCCTCCTCTGTAAAATGAGGGG + Intronic
969577323 4:8043992-8044014 CTGCTGGCCTGGAGAGTGAGTGG - Intronic
970502000 4:16687502-16687524 CTGCTGCTGTGCAGACTGGGTGG - Intronic
972319797 4:37963355-37963377 CTCTTGCTCTGCCATGTGAGAGG - Intronic
973255682 4:48109996-48110018 CTTCTCATCTGCAAAATGAGGGG + Intronic
973904489 4:55514504-55514526 CTACAGCTCAGCAAAGTGGGGGG - Intronic
975191335 4:71466510-71466532 GTGCTGCTCAGAATAGTGAGTGG - Exonic
978088101 4:104679898-104679920 CTGCTGCTACTAAAAGTGAGGGG + Intergenic
981582146 4:146260760-146260782 CAGCTGCTGTGAAAAGGGAGAGG + Intronic
981918236 4:150058272-150058294 CTGCTTCTGTGGAATGTGAGTGG - Intergenic
982785926 4:159536971-159536993 CAGCTTCTCTGCAAAGAAAGAGG - Intergenic
982999152 4:162389695-162389717 CTGCTGGTCTGCACATTTAGTGG - Intergenic
984179243 4:176461889-176461911 AAACTGCTCTGCACAGTGAGTGG - Intergenic
985732048 5:1554675-1554697 TTCCTTCTCTGCAAGGTGAGCGG + Intergenic
986128401 5:4904942-4904964 GTGCTTCTCTGCAGAGTGAAAGG - Intergenic
986533019 5:8758993-8759015 CTGTTGCTATGCAAAGAGACTGG + Intergenic
986605557 5:9520091-9520113 CTGCTGCTAGGCCAGGTGAGGGG - Intronic
995080707 5:108047825-108047847 CTGCTGGTCTGCAGAGACAGTGG - Intronic
995536907 5:113145684-113145706 CTGCTGCTCTGCCTATGGAGTGG + Intronic
995941329 5:117588396-117588418 CAGCTGGTCTCCAAAGTCAGGGG + Intergenic
997392329 5:133527220-133527242 CCACTTCTCTGCAAATTGAGGGG + Intronic
998105960 5:139469412-139469434 GACCTGATCTGCAAAGTGAGCGG - Intergenic
998391697 5:141791089-141791111 CTGCTACTCTGGAAGATGAGTGG - Intergenic
999868565 5:155728034-155728056 CCTCCGCTCTGCAAAGGGAGCGG + Intergenic
1000100093 5:158007985-158008007 CTTCCTCTCTGCAAAGTAAGTGG + Intergenic
1000116787 5:158161126-158161148 GTGCTGGTCTGCACGGTGAGTGG - Intergenic
1001143434 5:169164099-169164121 CTGCTCCTTTTCAAAGTCAGGGG + Intronic
1001481645 5:172092905-172092927 CTGCTTATCTGTAAAGTGAGAGG + Intronic
1001646501 5:173285955-173285977 CTGAAGCAGTGCAAAGTGAGGGG + Intergenic
1001839663 5:174864587-174864609 CTGCTGGTCTGCAGAGACAGTGG + Intergenic
1002133688 5:177095944-177095966 CTCCTCCTCTGTAAAGTGGGTGG + Intronic
1002254475 5:177949205-177949227 CTCCTGATTTGCATAGTGAGAGG - Intergenic
1002483518 5:179518607-179518629 CTCCTGATTTGCATAGTGAGAGG + Intergenic
1003138720 6:3454682-3454704 CTGCTGCCCTGCAAGGTAATGGG - Intronic
1003559809 6:7171187-7171209 CGCTTGCTCTGCAAAGTGATGGG - Intronic
1004476039 6:15973159-15973181 CTACTGGTCTTCAAATTGAGAGG + Intergenic
1005615550 6:27568980-27569002 CTGCTGCTCTGCCTATAGAGTGG + Intergenic
1006452107 6:34111257-34111279 CTGCTGCTCTTGAATGTGTGTGG - Intronic
1006904880 6:37526516-37526538 CAGTGGCTCTCCAAAGTGAGTGG - Intergenic
1007260946 6:40562605-40562627 CTGCTGCTCTGAAAACTTAAAGG + Intronic
1009803517 6:68573065-68573087 CTGCTGCTCTGTATAGGAAGGGG + Intergenic
1010882817 6:81200792-81200814 CTCATGCTATGCAAAGAGAGTGG + Intergenic
1011117437 6:83909076-83909098 CTGCTGTTCTGAAAGGTAAGTGG + Exonic
1012313446 6:97756386-97756408 CTGATGCTCTGCATAGCCAGTGG - Intergenic
1014135475 6:117884140-117884162 CTGCTGCTATGCAAAGACACTGG - Intergenic
1016989910 6:149921939-149921961 CTGTTGCTCTGCAAAGGGACAGG + Intronic
1016993141 6:149943123-149943145 CTGTTGCTCTACAAAGGGACAGG - Intronic
1016996716 6:149966200-149966222 CTGTTGCTCTACAAAGGGACAGG - Intronic
1017002085 6:150004047-150004069 CTGTTGCTCTACAAAGGGACAGG + Intergenic
1017005193 6:150024401-150024423 CTGTTGCTCTACAAAGGGACAGG + Intronic
1017011800 6:150068471-150068493 CTGTTGCTCTACAAAGGGACGGG + Intronic
1017260061 6:152375459-152375481 CTGCTGCTATGTGAAATGAGCGG + Intronic
1018245607 6:161819810-161819832 CTGCTGCTATGCTTAGTGATTGG - Intronic
1018260322 6:161963890-161963912 CTGCTGCTCTGCAAAATTGCAGG - Intronic
1019273624 7:164478-164500 CTGGAGCTCAGCAGAGTGAGGGG - Intergenic
1019982523 7:4631932-4631954 CCGCTGCACAGCAAAGGGAGAGG - Intergenic
1020650811 7:10873978-10874000 CTGATGAACTGAAAAGTGAGTGG + Intergenic
1021211888 7:17863717-17863739 GTGCTGCTCTGCAAGGTTTGAGG + Intronic
1022167873 7:27788885-27788907 CTGCTGCTTTGCACATTCAGTGG + Intronic
1022746822 7:33181056-33181078 CTACTGCTGTGCTGAGTGAGTGG + Intronic
1023364527 7:39450570-39450592 CTGTTGCTCTGAGAAGTGAGAGG - Intronic
1024537289 7:50448048-50448070 TTTCTTATCTGCAAAGTGAGAGG + Intronic
1024553643 7:50584496-50584518 CTGCTGCTCACCAAAGGGAAAGG - Intergenic
1025603573 7:63022896-63022918 CTGCTGCTCTGGACGATGAGGGG + Intergenic
1026569084 7:71513840-71513862 CTGCTGCTCTGTAGAGTGTAAGG + Intronic
1026653391 7:72235542-72235564 CTGCTGCACAGCAGAGTGTGTGG - Intronic
1028018796 7:85745523-85745545 CTACTGCTCTGCAGAGTGAGTGG - Intergenic
1029088719 7:98031777-98031799 CTACTCAGCTGCAAAGTGAGGGG - Intergenic
1029482935 7:100823925-100823947 CTCCTTCTCTGCACAGTGGGAGG - Exonic
1029687607 7:102159550-102159572 CTGTTGCTCTGAAAAGAAAGTGG + Intronic
1029969186 7:104772601-104772623 CTGCTGCTCTGCAAAGTGAATGG + Intronic
1032743796 7:134765818-134765840 GTGCTGCCCTGAAAAGTGATTGG + Intronic
1032776845 7:135122419-135122441 CTGCTGGTCTGCAAAGACTGTGG - Intronic
1033321642 7:140345162-140345184 CTGTTGCTCTGTAAATTCAGAGG - Intronic
1033620429 7:143057691-143057713 CTGCTGCTCTGCACAGCGTCAGG - Intergenic
1034507904 7:151509617-151509639 CTGCTGTTCTGTGAAGTGGGAGG - Intronic
1034712566 7:153206812-153206834 CTGCTAAGCTGCCAAGTGAGAGG - Intergenic
1035527027 8:321895-321917 CTTCTGCAGTGCAAACTGAGAGG + Intergenic
1036622643 8:10435225-10435247 TTGCTGCATTGCACAGTGAGAGG + Intergenic
1037091830 8:14929332-14929354 GTGCTGCTATATAAAGTGAGAGG + Intronic
1039020510 8:33199677-33199699 GTGATGCACTACAAAGTGAGCGG + Intergenic
1044706135 8:95010419-95010441 ATGCTGTTATGCAAAGTGAAGGG + Intronic
1046633839 8:116650172-116650194 CTGCTGCTATGCAAATAGACTGG + Intronic
1047197656 8:122736053-122736075 TTTCTCCTCTGCAAAGTGAGGGG - Intergenic
1047207758 8:122817334-122817356 CTGGTGCTGGGCACAGTGAGTGG - Intronic
1047295178 8:123564406-123564428 GTCCTCCTCTGTAAAGTGAGAGG - Intergenic
1048473370 8:134722618-134722640 TTCCTCATCTGCAAAGTGAGAGG - Intergenic
1049851146 8:144831265-144831287 CTGCTGCTGTGCCAAGTCACAGG + Intronic
1050900368 9:10940754-10940776 ATGCTGCTGTGCAATGTCAGAGG - Intergenic
1052626296 9:30981172-30981194 CTGCTGTCCTGCAAACTGGGAGG + Intergenic
1052707407 9:32010465-32010487 CTGCTGCCCTGTGCAGTGAGAGG - Intergenic
1052966883 9:34347057-34347079 GTGCTGCTCTGCCAGTTGAGAGG - Intergenic
1053152707 9:35753167-35753189 CGGCTGCCCTGCAAAGGGGGAGG - Exonic
1053463191 9:38286553-38286575 CTGATGCTCAGCTAGGTGAGGGG - Intergenic
1054469573 9:65523956-65523978 CAGCTGCTCTCCCAAGTGAAAGG - Intergenic
1054859384 9:69933244-69933266 CTACTGCTGTGCAGAGTGAGTGG - Intergenic
1056688416 9:88785374-88785396 CTGGTGCTCTGGAAATTGACGGG - Intergenic
1057568099 9:96182700-96182722 CTGGTGCTCAGCAGAGGGAGTGG - Intergenic
1058022547 9:100104130-100104152 CTGCTCATCTGTAAAATGAGAGG - Intronic
1058822273 9:108743758-108743780 CTGCTGCCCTCCAAGGCGAGTGG - Intergenic
1059069577 9:111121035-111121057 CTCTTGCTATGCAAAGAGAGTGG - Intergenic
1059567870 9:115401200-115401222 CTGATGCCCTGCACAGAGAGAGG + Exonic
1059969327 9:119648825-119648847 CTGCCCATCTGCAAAATGAGAGG - Intergenic
1060232365 9:121835093-121835115 CTTCCCCTCTGTAAAGTGAGGGG + Intronic
1060376986 9:123124489-123124511 GTGCTGCTGTGAAAAGTGACAGG - Exonic
1061504566 9:131024619-131024641 GTGCTGCTCTGGGAAGTGAGAGG + Intronic
1062094977 9:134698474-134698496 CTGAGGTTCTGCAAAATGAGGGG - Intronic
1185712952 X:2318768-2318790 GTGCTGCTCTGCCAATGGAGTGG + Intronic
1187040141 X:15585997-15586019 CTTCAGCTCTGCAAAGTGCTGGG - Intronic
1189060316 X:37746621-37746643 CTGCTGCTCTGGAAAGGCTGTGG + Intronic
1191615675 X:63167316-63167338 CTGCATCTCTGCACAGAGAGAGG - Intergenic
1191620623 X:63211607-63211629 CTGCATCTCTGCACAGAGAGAGG + Intergenic
1192216920 X:69165385-69165407 CTGCTTCTCTGAAAAGCGTGTGG - Exonic
1192951972 X:76026644-76026666 CTGCTGGTCTGCAAAGACTGCGG - Intergenic
1194339892 X:92694719-92694741 CTGTTGCTATGCAAAGAGACTGG - Intergenic
1194830845 X:98620562-98620584 CTCCTGCTATGCAAAGGGACTGG - Intergenic
1195301371 X:103533432-103533454 CTTCTCCTCAGCATAGTGAGAGG + Intergenic
1195816691 X:108896195-108896217 CTCTTGCTATGCAAAGAGAGTGG + Intergenic
1196164581 X:112524515-112524537 CTGCTGCTCTAACAAGTGTGAGG + Intergenic
1198707673 X:139466683-139466705 CTGCTGTTCTCCAAAGATAGGGG - Intergenic
1200648279 Y:5811502-5811524 CTGTTGCTATGCAAAGAGACTGG - Intergenic