ID: 1164639581

View in Genome Browser
Species Human (GRCh38)
Location 19:29813962-29813984
Sequence GCTGCTGCTCTGCAAAGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 305}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164639581_1164639588 6 Left 1164639581 19:29813962-29813984 CCCTCACTTTGCAGAGCAGCAGC 0: 1
1: 0
2: 1
3: 31
4: 305
Right 1164639588 19:29813991-29814013 AGTTCATCTGGAAGCGTGAAGGG 0: 1
1: 0
2: 0
3: 5
4: 113
1164639581_1164639585 -6 Left 1164639581 19:29813962-29813984 CCCTCACTTTGCAGAGCAGCAGC 0: 1
1: 0
2: 1
3: 31
4: 305
Right 1164639585 19:29813979-29814001 AGCAGCCAGGGTAGTTCATCTGG 0: 1
1: 0
2: 0
3: 8
4: 126
1164639581_1164639587 5 Left 1164639581 19:29813962-29813984 CCCTCACTTTGCAGAGCAGCAGC 0: 1
1: 0
2: 1
3: 31
4: 305
Right 1164639587 19:29813990-29814012 TAGTTCATCTGGAAGCGTGAAGG 0: 1
1: 0
2: 0
3: 5
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164639581 Original CRISPR GCTGCTGCTCTGCAAAGTGA GGG (reversed) Intronic
900266621 1:1760391-1760413 GGAGCTGCTCTGCAAAGTGTGGG - Intronic
900733056 1:4275633-4275655 GCAACTGTTCTGCAGAGTGAGGG - Intergenic
901944144 1:12687262-12687284 GATGCTGCTCAGCAAAAAGAAGG + Intergenic
902205784 1:14867146-14867168 GCTGCTCCCCTGCACAGGGAGGG - Intronic
902330703 1:15729961-15729983 GCTGCTGCTCTGCCATCTCAGGG - Intronic
902715613 1:18270560-18270582 GCAGATGCTCTGCACAGGGAAGG - Intronic
902907417 1:19568666-19568688 CCTGCTGCTTGGCTAAGTGAGGG - Intergenic
904065829 1:27750011-27750033 GCTGCTTCTCAACAAAGTGTTGG + Intronic
905581393 1:39085050-39085072 GCTGCTGCTTGGCAAAGAGCTGG - Intronic
905596845 1:39214957-39214979 GCTTCTGCTCTGCAAATGGAGGG + Intronic
906729170 1:48066454-48066476 CCAGCTGCTGTGCAAAGTGCTGG - Intergenic
907278968 1:53332541-53332563 GCTGCCCTTCTGTAAAGTGAAGG - Intergenic
907511798 1:54967042-54967064 TCTTCTGGTCTGCAAAGTGTGGG + Intergenic
907831822 1:58071430-58071452 GCTGCTGGGCTGCTAAGAGAAGG + Intronic
908576847 1:65468914-65468936 GCTGCTGCTCTGTTCAGTGCCGG + Intronic
909483683 1:76151579-76151601 GCTGCAGCTGTCCACAGTGATGG - Intronic
910951566 1:92653703-92653725 GCTGCTGCTCTGCATGGAGAGGG - Intronic
911144389 1:94538679-94538701 ACTGTTGCTCTGAGAAGTGAGGG - Intronic
915015558 1:152729956-152729978 CCTGCTGCTCTGCAGGGTGGGGG + Intergenic
915363087 1:155297583-155297605 GCTGCTGCACTGAAAATAGATGG - Intronic
915853514 1:159354035-159354057 GAGGCTTCTCTGAAAAGTGAGGG + Intergenic
916856490 1:168755750-168755772 GCTTGTGCTCTGCAGAGAGAGGG + Intergenic
917577552 1:176339882-176339904 TCTGCTGCTTTGCATAATGAGGG + Intergenic
919141454 1:193577618-193577640 GCAGATACTCTGCAGAGTGACGG + Intergenic
919435086 1:197548383-197548405 GCTGATGCTCAGCCAAGTTAAGG - Intronic
921026421 1:211287231-211287253 ACTCCTGCTCTGCAGAGGGAGGG - Intronic
921187879 1:212685411-212685433 GCCCCTTCTCTGCAAAGTGGAGG + Intergenic
921214404 1:212924839-212924861 CCTCCAGCTCTGCAAAGGGAGGG + Intergenic
922798674 1:228353898-228353920 GCTGCAGCTCTGCCAGGTGTTGG - Intronic
922959955 1:229637907-229637929 GCTGCAGCTCTGCTCAGTGCCGG + Exonic
923126666 1:231039920-231039942 GGCGCTGCTCCGCAAAGAGATGG - Exonic
923563703 1:235060936-235060958 GCTGCTGCATTGCAAAGAGCAGG - Intergenic
1063746206 10:8885095-8885117 GCCTCTGCCCTGCAAAGTGCTGG - Intergenic
1064012194 10:11743534-11743556 TCTGCTGCTCTGCAAGGGGCTGG + Intronic
1069597300 10:69680602-69680624 GTTGCTCATCTGCAAAGTGGGGG + Intergenic
1070809622 10:79291057-79291079 GCTGCTGCCCCGCAAACTGTGGG - Exonic
1072537675 10:96375590-96375612 ACTGCTGCTCTGCTAAGAGCTGG - Intronic
1072546374 10:96442551-96442573 GCTGCTGTAATGCAGAGTGAAGG + Intronic
1073330710 10:102668445-102668467 CCTGCTGCTCAGCCAAGGGATGG + Intergenic
1073592441 10:104769807-104769829 GCTCCTTATCTGCAAAATGAAGG + Intronic
1074405509 10:113177418-113177440 GCTGCTGCTCGGACAAGTGGGGG + Intergenic
1074445493 10:113518024-113518046 GCTGCTGTTCTGCACGGTGATGG + Intergenic
1074452940 10:113574144-113574166 TCTCCAGCTCTGCACAGTGAGGG - Intronic
1074619891 10:115107779-115107801 GCTGCAGCTCTGAAAAGTATAGG - Intronic
1074869985 10:117568777-117568799 CCTGCTACTCTGCAAATTGCTGG - Intergenic
1074945335 10:118275817-118275839 CCTTCTGCTCTGCAGAGTGTTGG + Intergenic
1075912194 10:126134148-126134170 TCTGCTACTCTGAAAAGTGAAGG - Intronic
1078549632 11:12271206-12271228 GCAGCTGCTCTGCAGGGTGCTGG + Intergenic
1079918842 11:26406221-26406243 TCTGCTCTTCTGCTAAGTGAGGG - Intronic
1080064113 11:27989683-27989705 TATGTTGCTCTGCAAAGTGCTGG - Intergenic
1080481988 11:32661173-32661195 TCTGCAGTTCTGCAGAGTGAAGG + Intronic
1086167738 11:83798928-83798950 GGAGCTGCTCTGAAAAATGAAGG + Intronic
1086333802 11:85779985-85780007 TCTCCTCATCTGCAAAGTGAGGG + Intronic
1087716730 11:101617087-101617109 GCTGCTGCCTTGCAGAGTGCAGG - Intronic
1089213736 11:116823086-116823108 GCTGCTGCTCTGAGTAGTGCAGG - Intronic
1090063451 11:123483634-123483656 GCTTCAGCCCTGCAAAGTGTTGG + Intergenic
1090206644 11:124887832-124887854 GCTGCAGCTCTGCAAAGAAAGGG + Exonic
1091614782 12:2041789-2041811 GCTGCTGCTCTTCACAGGGAAGG - Intronic
1092122445 12:6053991-6054013 GCAGCTGGTCTGCACAGGGAAGG - Intronic
1092359722 12:7826078-7826100 TCTGCTGCTCTGGAAAGTCTCGG + Intronic
1092372491 12:7928684-7928706 TCTGCTGCTCTGGAAAGTCTCGG + Intronic
1092384176 12:8023015-8023037 GCTGCTGGTCAGCAGAGTCATGG + Intergenic
1093680769 12:21999564-21999586 CCAGCTTCTCTTCAAAGTGAAGG + Intergenic
1094142032 12:27191297-27191319 GCTGCTGCTCTGCTGTGTGGTGG + Intergenic
1096497068 12:52044749-52044771 GCTGATGTTCTGCAAGGTGGTGG + Intronic
1097372447 12:58800754-58800776 GCTTCTGATCTGGAAAGTGATGG + Exonic
1098594988 12:72262056-72262078 GCTTCTGCTCTGCAGATGGATGG - Intronic
1101905474 12:108821929-108821951 GCTGCTGTTCTGAAAGGTAAAGG + Intronic
1102019899 12:109675099-109675121 GCTTCTTCTCTGCACAGAGAAGG - Intergenic
1103232259 12:119341329-119341351 GCAGCTGCTCTGCAGGGGGAGGG + Intronic
1105474099 13:20716543-20716565 CCTGGTTCTTTGCAAAGTGAAGG - Intronic
1105623665 13:22092642-22092664 GCAGATGCTCTGCAAGGTGCAGG + Intergenic
1105971356 13:25431655-25431677 GTTGCTTCTCTGTAAAGTGTGGG + Intronic
1106450367 13:29876149-29876171 GTTGCTCCTTTGCAAAGTGAAGG - Intergenic
1106548779 13:30753633-30753655 GCTTCTGCTCTATAAAGTGAGGG - Intronic
1107674030 13:42776453-42776475 GCTCCAGCTCTGCTAAGGGACGG - Intergenic
1108548546 13:51520572-51520594 GCTGCAGCTCTGCTCAGAGAAGG - Intergenic
1108602238 13:52004948-52004970 GCTGCTGCTCTGGAAGGTGCAGG - Intronic
1111048841 13:82851668-82851690 GCTTCAGCTCTCCAAAGTGCTGG + Intergenic
1111199846 13:84920198-84920220 CCTGCTGCTCTGTAAAGAGGTGG + Intergenic
1111622810 13:90746294-90746316 GCCACTGCTCTGAAAAGTGATGG - Intergenic
1112372974 13:98811085-98811107 TCTGCTGCCCAGCAAAGTGATGG + Intronic
1112988613 13:105482753-105482775 GCTTCTGCTCCTCAAAGTGCTGG + Intronic
1113107224 13:106784710-106784732 GATGCTGCTCTGCAGGGTGCTGG + Intergenic
1113729193 13:112627410-112627432 GAGGCTGCTCTGCTAGGTGATGG + Intergenic
1115949536 14:38704716-38704738 TCTCCTGCTCTGGAAAATGATGG - Intergenic
1116470255 14:45278428-45278450 GTTGCTGCTCTGAAAAGTACTGG - Intergenic
1117702910 14:58432963-58432985 GCTTCGGCCCTGCAAAGTGCTGG + Intronic
1118678756 14:68217147-68217169 CCTGCTGCTCTCCTAAGTGGTGG + Intronic
1119656963 14:76424100-76424122 TTTGCTCCTCTGCAAAATGAGGG + Intronic
1121080488 14:91103981-91104003 ACTACTGCTCTGCAGAGTGGTGG - Intronic
1122117344 14:99534529-99534551 GCTACTGCTCTGCAGAGCAAGGG - Intronic
1122208709 14:100161031-100161053 TCTCCTGATCTGTAAAGTGATGG - Intergenic
1122599419 14:102913878-102913900 GCTGCTGCAGTGCAGAGTCAGGG - Intergenic
1122650420 14:103223208-103223230 GCTGCTGCTCAGCCTAGTAAAGG - Intergenic
1122879702 14:104685218-104685240 GCTGCTGCTCTTAGAAGGGACGG - Intergenic
1123157301 14:106240636-106240658 GCTGCTTCTCTGCAGAGTTCAGG - Intergenic
1123165319 14:106320203-106320225 CTTGCTGCTCTGGAAAGTGCAGG + Intergenic
1123188603 14:106545010-106545032 GCTGCTTCTCTGCAGAGTTCAGG - Intergenic
1124035286 15:26048809-26048831 GCTGCTGTGCAGCAAACTGAAGG - Intergenic
1124957173 15:34367145-34367167 GCAGCTGCTCTGCAGAGTGGTGG - Exonic
1127485416 15:59413669-59413691 GCCACTGCTTTGCAAAGTGCTGG - Intronic
1127807894 15:62537914-62537936 GCTGCTGCTCTTAACAGTGTGGG - Intronic
1127841528 15:62836016-62836038 GCTGGTGGCCTGCAAGGTGAAGG + Exonic
1130842186 15:87711065-87711087 GATTCTGCTCTGCAAAGTAGAGG + Intergenic
1131538157 15:93254446-93254468 ATTGCTGCTTTGCAAAGTGAGGG + Intergenic
1132867235 16:2099555-2099577 GCTGCAGCACTGGAAAGTGGCGG + Intronic
1133691607 16:8221042-8221064 GCTGTTGCTCTTCATAGTGGAGG + Intergenic
1134524540 16:14933560-14933582 GCTGCAGCACTGGAAAGTGGCGG - Intronic
1134548363 16:15127381-15127403 GCTGCAGCACTGGAAAGTGGCGG + Intronic
1134712129 16:16332047-16332069 GCTGCAGCACTGGAAAGTGGCGG - Intergenic
1134719986 16:16375340-16375362 GCTGCAGCACTGGAAAGTGGCGG - Intergenic
1134947440 16:18336545-18336567 GCTGCAGCACTGGAAAGTGGCGG + Intronic
1134954700 16:18376647-18376669 GCTGCAGCACTGGAAAGTGGCGG + Intergenic
1136569242 16:31086890-31086912 GCTGCTGCCCTGGAAGGGGAAGG + Exonic
1137329644 16:47479608-47479630 ACTTCTGCTCTTCAAAGTGCAGG - Intronic
1137864676 16:51881012-51881034 ACTGCTGCTCTCCAGAGAGATGG + Intergenic
1138051876 16:53787181-53787203 GCTGCTGCCCTAGAAATTGAAGG - Intronic
1138831444 16:60379748-60379770 GCTGCTGCTCATAAAAGTAAAGG - Intergenic
1139111404 16:63895547-63895569 ATTGCTGCTCTGCAAAGGGAAGG - Intergenic
1139715820 16:68812165-68812187 GCTGCTGACCTTCAAGGTGAGGG + Exonic
1141702493 16:85648884-85648906 TCTCCTTCTCTGCAACGTGAGGG + Intronic
1142602861 17:1064235-1064257 GCTGCTGTTATGTAAACTGAGGG + Intronic
1142860107 17:2755966-2755988 TCTGCGGCTCTCCAAAGAGATGG + Intergenic
1143322111 17:6075148-6075170 GCTCCTGCCCTGCAAAGAGCAGG + Intronic
1147121149 17:38335813-38335835 GCTGCTCCTCTGCAGAATGAAGG - Intronic
1148336130 17:46842329-46842351 GCTGCTGCTCTACAACCTCAGGG + Intronic
1149851676 17:60040087-60040109 CCTGCTGCTCTGAAAATTCAAGG + Intergenic
1150836314 17:68567440-68567462 GCTTCTGTTCTGCCCAGTGAAGG + Intronic
1151427588 17:74041078-74041100 GCTGCTAATCTGTAAAGTGGGGG - Intergenic
1151458515 17:74240950-74240972 CCTGCTGCTCTGCAGAGCGGAGG + Intronic
1151825715 17:76523169-76523191 GCTGCAGCTCCCGAAAGTGAGGG + Intergenic
1152742686 17:82025225-82025247 GCCTCTGCTCTGGGAAGTGAGGG + Intronic
1153304820 18:3622000-3622022 GCTGCTGCTTTGCCAACAGAGGG + Intronic
1156946658 18:42841288-42841310 GCTGCTATTATGCAAACTGAAGG - Intronic
1157667696 18:49501538-49501560 GGAGCTGCTCAGCAAAGGGAGGG - Intergenic
1157887974 18:51387019-51387041 GCTGCAGCCCTCCAAAGTGTTGG + Intergenic
1159494785 18:69188927-69188949 TCTTCTGCTCTGCTATGTGAGGG - Intergenic
1160097735 18:75890555-75890577 GCTGCTGCTCTCCATGGAGATGG + Intergenic
1160909229 19:1467237-1467259 GCCGGTGCCCTGCAAAGTGGAGG - Exonic
1160923941 19:1534014-1534036 GCTGCTGTTCAGCAATGGGATGG + Exonic
1161745715 19:6058499-6058521 CCTGCTGCTCTGGAATGTGTGGG - Intronic
1164639581 19:29813962-29813984 GCTGCTGCTCTGCAAAGTGAGGG - Intronic
1165232116 19:34393784-34393806 GCTGGTTCTCTGCCAAGTGCTGG + Intronic
1165253598 19:34559286-34559308 GCTGGTGCTCTGGGAAGTCAGGG + Intergenic
1165812209 19:38618298-38618320 GCGGCAGGTCTGCAAAGGGATGG + Intronic
1165900955 19:39169143-39169165 ACTGCTGCTCTGAGAACTGAAGG + Intronic
1166992952 19:46704271-46704293 GATGCTGCTCTCCAAGGTCAAGG - Exonic
1168039464 19:53746434-53746456 GCTACCGCTGTGCTAAGTGACGG + Intergenic
1168541926 19:57220040-57220062 TATTCTGCTCTGCAAAATGAAGG - Exonic
1168555731 19:57338362-57338384 TCTCCTGCTGTGCAAAGGGAAGG + Intergenic
925449480 2:3956562-3956584 GCTGCAGCCCTTCAAAGTGCTGG - Intergenic
926684975 2:15691323-15691345 GCTGCTGCTCAACACAGAGATGG - Intronic
927428572 2:23007756-23007778 CCTGCAGTTCTGCAAAGTGTAGG - Intergenic
927993533 2:27465510-27465532 GCTGTTGCCCTGGAAAGGGAAGG + Exonic
929763581 2:44825971-44825993 ACAGCTGCTCTGCAGAGCGAGGG + Intergenic
930506085 2:52284250-52284272 ACTGCTGCTGAGGAAAGTGAGGG - Intergenic
931093094 2:58908220-58908242 GCAGATGCTCTAGAAAGTGAGGG + Intergenic
932766960 2:74476796-74476818 GCAGCTGCTCTGTAAAGAAATGG + Intronic
934557800 2:95296667-95296689 GGTGCTGGTCTGCAAGGTGCTGG - Intergenic
934570991 2:95373223-95373245 GATGCTGCTCAGCAAGGTGTGGG + Intronic
935925971 2:108068766-108068788 GGTTCTCCTCTGCAAAGTGCGGG + Intergenic
936075881 2:109401611-109401633 GCAGCAGCTTTGCAAAGTCATGG - Intronic
940696632 2:156986922-156986944 CCTGCTTCTCTGCAAAATAAAGG + Intergenic
941575022 2:167219466-167219488 ACTGCTTCCCTTCAAAGTGAAGG - Intronic
943743156 2:191433195-191433217 TTTTCTTCTCTGCAAAGTGAAGG - Intergenic
945203280 2:207306281-207306303 CCTGCTGTTCTGCAAGGGGAAGG + Intergenic
945875241 2:215271636-215271658 CCTGCTGCTTTGCATTGTGATGG - Intergenic
948353797 2:237361250-237361272 AGTGCTGCTCTGCCAAATGAAGG - Intronic
949006327 2:241650784-241650806 GCAGCTGCTCTGCTAAGGTATGG - Intronic
1169340012 20:4789595-4789617 GCTGCTGCTCAACAAATTTAAGG - Exonic
1169378838 20:5089123-5089145 GCTTCGGCCCTGCAAAGTGCTGG - Intronic
1171130808 20:22651696-22651718 GTTTCTGCTCTGCAATGTCACGG + Intergenic
1171283056 20:23917499-23917521 GCTGCTGCCATGAACAGTGAGGG - Intergenic
1171380846 20:24732894-24732916 GCTGCTGCTCTGAGGAGTGTAGG + Intergenic
1172478386 20:35255768-35255790 TCTCCTCGTCTGCAAAGTGAGGG + Intronic
1172870343 20:38131747-38131769 GCTGCGGCTCCTCTAAGTGAAGG + Intronic
1173731275 20:45330394-45330416 GTTGCTGCCCTGCACAGTGCTGG + Exonic
1173747484 20:45448936-45448958 GCTGCTGTTCTGCAAAATATTGG - Intergenic
1174301201 20:49583891-49583913 GCTGCTGACCTGCAAACAGATGG + Intergenic
1175651635 20:60729743-60729765 GCTGCTGATCTGATAAGAGACGG - Intergenic
1176082763 20:63282226-63282248 GCTGACGCTCGGCAAAGTCACGG - Intronic
1176213284 20:63936061-63936083 GCTGCTGCTCTCCAAAACCAGGG - Intergenic
1176680510 21:9816841-9816863 GCTCCTGCTCTGCAAAGCCTCGG + Intergenic
1176681078 21:9819653-9819675 GCTCCTGCTCTGCAAAGCCTCGG + Intergenic
1176681927 21:9823890-9823912 GCTCCTGCTCTGCAAAGCCTCGG + Intergenic
1178698059 21:34810974-34810996 GCTGCTGCTCTGCAGGAGGAAGG - Intronic
1178777107 21:35562421-35562443 GCTGCTTCTGTGACAAGTGATGG - Intronic
1179253641 21:39696676-39696698 GCTGCTGTGATGCAAAGTGTAGG - Intergenic
1179294825 21:40052343-40052365 GCTCCTTCTCTGCATAGTCATGG - Intronic
1179722803 21:43325014-43325036 GCTGCAGCTCTGCACAAGGAGGG + Intergenic
1179786287 21:43732038-43732060 GCTGCTGCTATGGGAAGGGACGG + Intronic
1179890285 21:44331735-44331757 GCTGCGTCTCTGGGAAGTGAGGG - Intronic
1179990094 21:44943516-44943538 GCTTCTGCTCTGGGAGGTGAGGG + Intronic
1180082513 21:45493325-45493347 GCTGCTGCTGTGACACGTGAGGG + Intronic
1181035080 22:20166067-20166089 GCTGATGCCCTGCACAGCGAGGG + Intergenic
1181508737 22:23379300-23379322 GCTGATGCCCTGCACAGTGAGGG - Intergenic
1181785560 22:25224214-25224236 ACTGAAGCTCTGCAAAGTGAAGG - Intronic
1182072676 22:27474836-27474858 GCTCCATCTCTGCAGAGTGAAGG - Intergenic
1182248432 22:28979643-28979665 GTCTCTGCTCTGCTAAGTGAGGG - Intronic
1183040598 22:35174967-35174989 GCTGCTGCACAGCATGGTGAGGG - Intergenic
1183704355 22:39467946-39467968 ACTGCTGCTCATCAAGGTGAGGG - Intronic
949342197 3:3042163-3042185 ACTGCCCCTCTGCAAAATGAGGG + Intronic
950048762 3:9969689-9969711 GCTGCAGCTTTGAAAGGTGAAGG + Intronic
950257095 3:11514378-11514400 CCTGCTGATCTGAAAAGGGAAGG - Intronic
950478973 3:13233058-13233080 GTGGCTGCACAGCAAAGTGAAGG + Intergenic
950538407 3:13595059-13595081 TCTGCTGGTCTGCAAAATGGGGG + Intronic
953063009 3:39443473-39443495 GGTCCTGCACTGGAAAGTGATGG + Intergenic
953239741 3:41138107-41138129 TGTGCTGCTCTGAAAAGTAAAGG + Intergenic
953428796 3:42819690-42819712 GCTGCCTCTCTGCAAAGTTGAGG + Exonic
953677223 3:45012401-45012423 GCTGCTTCTCTCCACAGGGATGG - Intronic
956638394 3:71390189-71390211 GCTGCTGGGATGCAAGGTGAAGG - Intronic
959115403 3:102171695-102171717 GCTGCAGCTCTCCAAAGTCCAGG - Intronic
959146676 3:102555141-102555163 GCCTCTGCCCTGCAAAGTGCTGG - Intergenic
959478112 3:106837151-106837173 GCTGCTGCTCTGAACAGGGTTGG - Intergenic
961325827 3:126108722-126108744 GCTGCTGCTCGGCTTAGTGGAGG - Intronic
961723419 3:128910476-128910498 GCAGGTGCTCTGGAAAGTGCAGG - Intronic
962954292 3:140249881-140249903 GCTGTTGCCCTGCGGAGTGAGGG - Intronic
964525229 3:157610093-157610115 GCTGTGGCTGTGCAAAGGGAAGG + Intronic
964725014 3:159805523-159805545 GTTGCTGATCAGCAAGGTGAGGG - Intronic
965119672 3:164537770-164537792 ACTACTGCTATGCAAATTGAGGG - Intergenic
965550464 3:169959793-169959815 GCTGCTGCCCAGCAAGGTCATGG + Intergenic
965631454 3:170737347-170737369 GCTTCTTTTCTGCACAGTGAAGG + Intronic
966882586 3:184358675-184358697 GCTGCCTGTCTGCAAGGTGAGGG - Exonic
968968123 4:3779663-3779685 GCTGCTGCACAGCCATGTGACGG - Intergenic
969315571 4:6379768-6379790 GCTCCTCCTCTGTAAAATGAGGG + Intronic
970813819 4:20128919-20128941 GCTACTGCTCTGAAAGCTGAGGG + Intergenic
971558839 4:28047953-28047975 GCTGCTGCTGTGGAAAGAGGGGG + Intergenic
972373670 4:38450072-38450094 GCTGCAGCTCTGCATAGTTGGGG + Intergenic
973131551 4:46654102-46654124 GCTTCGGCTCTACAAAGTGGAGG + Intergenic
975544217 4:75545390-75545412 GCTCCTGCTCTGCAAACTGAAGG + Intronic
986048040 5:4059895-4059917 GCTGCTGTTCTACAGAGAGAGGG + Intergenic
986605558 5:9520092-9520114 GCTGCTGCTAGGCCAGGTGAGGG - Intronic
986671529 5:10146944-10146966 GCTGCTGGTCTGGAAAGTCTTGG - Intergenic
987114614 5:14716250-14716272 GCTCCTCCTCGGCAAAGTGCTGG - Intronic
990210936 5:53480836-53480858 GCTGCTGCTCTGCCAGTTCATGG + Exonic
991071794 5:62491475-62491497 GCTTCTGCACTGGACAGTGAAGG - Intronic
996324581 5:122258522-122258544 GCTGCTTCTCTGCGTAGGGAGGG + Intergenic
996354859 5:122584550-122584572 GCTGTTGCTTTGCAAACTGAAGG - Intergenic
996618498 5:125470741-125470763 GCTGCCACTCTGCACAGTGGGGG + Intergenic
997575879 5:134976854-134976876 GCTTGTGCTCTCCAAAGTCATGG + Intronic
1001294616 5:170490179-170490201 GCTCCTCCCCTGCAAAGTGAAGG + Intronic
1001583541 5:172817119-172817141 TCTGCTCATCTGCAAAGTGGGGG + Intergenic
1001646500 5:173285954-173285976 GCTGAAGCAGTGCAAAGTGAGGG + Intergenic
1001647198 5:173290732-173290754 GCTGCAGCTCTGCACAGAGAGGG + Intergenic
1003097663 6:3155407-3155429 GAGGCTGCTCTGCAATGGGAGGG + Intronic
1003101347 6:3178714-3178736 GAGGCTGCTCTGCAATGGGAGGG + Intergenic
1003138721 6:3454683-3454705 CCTGCTGCCCTGCAAGGTAATGG - Intronic
1003559810 6:7171188-7171210 ACGCTTGCTCTGCAAAGTGATGG - Intronic
1003678937 6:8233112-8233134 GTTGCTTCTTTGCAAAGTGGTGG - Intergenic
1004512337 6:16293243-16293265 GTTGCTTCTCTGCTAAGTGGTGG - Intronic
1004638368 6:17490153-17490175 GCAGCTGCAGTGCAAATTGAGGG + Intronic
1005945124 6:30589823-30589845 GCAGCTGCTCTGCATACTGCTGG - Exonic
1006298290 6:33179687-33179709 GCTGCTTCCCTGGAAAGGGAAGG - Intronic
1007589320 6:43011962-43011984 GCTGCTGCTCACCAAAGACAGGG - Exonic
1008226185 6:48919862-48919884 GCTGCTGCTTTGAAGAGTGCTGG + Intergenic
1009803516 6:68573064-68573086 GCTGCTGCTCTGTATAGGAAGGG + Intergenic
1012082367 6:94776980-94777002 GAAGCTGGGCTGCAAAGTGATGG + Intergenic
1012190965 6:96279547-96279569 GCTGTTGTTCCACAAAGTGATGG + Intergenic
1012207403 6:96478406-96478428 GCTCCAGCTCTGCTAAGGGACGG - Intergenic
1015681255 6:135811316-135811338 GCTGCTGCTCTAAAAACAGAAGG - Intergenic
1016422834 6:143902568-143902590 GCTGCTGCTCTGCAGGGAGGGGG + Intronic
1017011799 6:150068470-150068492 GCTGTTGCTCTACAAAGGGACGG + Intronic
1021372868 7:19871665-19871687 ACTGCTGCTCTGACAAGAGAGGG - Intergenic
1023352339 7:39333116-39333138 GCACCTGCTCAGCAAAGTGTTGG - Intronic
1023529066 7:41134721-41134743 ACTGTTACTCTGTAAAGTGAAGG + Intergenic
1023710095 7:42982884-42982906 GCTGCTGCTGTTCAAACAGAAGG - Intergenic
1024094864 7:45975528-45975550 GCTGCTTCTCTGCCATGTTAGGG - Intergenic
1024177465 7:46855895-46855917 TCTGCTACTCTGAAAAGTGGTGG + Intergenic
1024638227 7:51308350-51308372 TCTGCTGCTTTGCCAAGTGCTGG + Intronic
1026239129 7:68556503-68556525 GCTGCTGCTGGGGAGAGTGAGGG - Intergenic
1027517574 7:79161693-79161715 GCTGCTGCTCTGGTAAAAGAAGG + Intronic
1027773874 7:82442572-82442594 GCTGCTGTTCTGGAAATAGAGGG - Intronic
1028174800 7:87643154-87643176 GCTTCAGCTTTGCAAAGTGTTGG + Intronic
1028729644 7:94131047-94131069 GCTGCGGCTTTCCAAAGTGCTGG - Intergenic
1029088720 7:98031778-98031800 GCTACTCAGCTGCAAAGTGAGGG - Intergenic
1029587056 7:101481150-101481172 TCTGCTGATCAGCAGAGTGAGGG - Intronic
1031085157 7:117295326-117295348 GCTGCAGCTCTGGCATGTGATGG + Intronic
1034062352 7:148104492-148104514 ACTCCTGCTCTGCACAGTGGTGG + Intronic
1034349660 7:150407695-150407717 GCTGCTCCTCTGCAGGGTGGTGG - Intronic
1034720589 7:153289228-153289250 CCTGCTGCTCTTCATAGTGTGGG - Intergenic
1034720892 7:153291483-153291505 GCAGCGGCTCTGCAATGTGACGG + Intergenic
1035837616 8:2771195-2771217 GGCGCTGCTCTGCAAGGGGACGG - Intergenic
1036286084 8:7445181-7445203 CTTGCTTCTCTGCAGAGTGAGGG + Intronic
1036335390 8:7866348-7866370 CTTGCTTCTCTGCAGAGTGAGGG - Intronic
1036961272 8:13247321-13247343 GATACTGCTTTGCAAAGTGTTGG - Intronic
1037342976 8:17866967-17866989 TCTCCTGCTTTGCAAATTGAAGG - Intronic
1037894318 8:22641719-22641741 GTGGGTGCTCTGCAAAGTTAGGG - Intronic
1038060538 8:23907440-23907462 GATGCTGCTTTGCAAATTCAAGG + Intergenic
1041017117 8:53601738-53601760 CCTCCTGCTCTGGAAAGTGAAGG - Intergenic
1041172820 8:55162306-55162328 GCTGCTACTCTGCACAGTGCTGG - Intronic
1041232848 8:55770904-55770926 GCCGCTGCTTCGCAAAGTGCTGG - Intronic
1043363328 8:79500862-79500884 GCTGCTGATATAAAAAGTGATGG + Intergenic
1043934099 8:86123391-86123413 ACTCCTGCTTCGCAAAGTGAGGG + Intronic
1044560218 8:93605449-93605471 AGTGCTGCTCTGCTCAGTGATGG + Intergenic
1044639196 8:94360585-94360607 GCCACAGCTCTGCAAAGTCAAGG - Intergenic
1044706134 8:95010418-95010440 TATGCTGTTATGCAAAGTGAAGG + Intronic
1044766580 8:95582102-95582124 GCTGCTTTTCTGGAATGTGAAGG + Intergenic
1046077844 8:109334007-109334029 GCTGCGGCCCTGGAAAGCGATGG - Exonic
1047197657 8:122736054-122736076 TTTTCTCCTCTGCAAAGTGAGGG - Intergenic
1047305755 8:123651925-123651947 GATGCTGCGGTGCAAGGTGATGG + Exonic
1047832468 8:128650603-128650625 GTTGATGCTCTGAGAAGTGATGG - Intergenic
1048461674 8:134626406-134626428 GCTGAGGCTCTGCTAGGTGAAGG - Intronic
1049451511 8:142664546-142664568 GCTGCCGCTCCGCAAAGCGCAGG + Exonic
1050051571 9:1607635-1607657 GGAGCTGCTTTGCAAAGGGAGGG - Intergenic
1050078954 9:1894652-1894674 GATGTTGCTCTGCAAATTCAGGG - Intergenic
1053382352 9:37659337-37659359 GCTGCTGCTCTGAAGGGTGCCGG + Intronic
1056646188 9:88413870-88413892 GCAGCTGGTATCCAAAGTGAGGG - Intronic
1056688417 9:88785375-88785397 CCTGGTGCTCTGGAAATTGACGG - Intergenic
1056821117 9:89842761-89842783 GCTGCAGCTCTGCAAGGTGTGGG + Intergenic
1057262733 9:93594464-93594486 CCTGCTGCTCTGGGAAGTGGTGG - Intronic
1057421254 9:94914726-94914748 GCTGCTGATCTGCACTGTGGTGG - Intronic
1059988786 9:119844857-119844879 GCTTCTGCTCTGCAATTTGATGG + Intergenic
1060232364 9:121835092-121835114 GCTTCCCCTCTGTAAAGTGAGGG + Intronic
1062582430 9:137234479-137234501 GCTGCTGCTCTGCAGTGCGAAGG - Exonic
1203665389 Un_KI270754v1:17964-17986 GCTCCTGCTCTGCAAAGCCTCGG + Intergenic
1203665956 Un_KI270754v1:20784-20806 GCTCCTGCTCTGCAAAGCCTCGG + Intergenic
1203666249 Un_KI270754v1:22193-22215 GCTCCTGCTCTGCAAAGCCTCGG + Intergenic
1203666536 Un_KI270754v1:23600-23622 GCTCCTGCTCTGCAAAGCCTCGG + Intergenic
1203666819 Un_KI270754v1:25012-25034 GCTCCTGCTCTGCAAAGCCTCGG + Intergenic
1203667103 Un_KI270754v1:26423-26445 GCTCCTGCTCTGCAAAGCCTCGG + Intergenic
1203667398 Un_KI270754v1:27832-27854 GCTCCTGCTCTGCAAAGCCTCGG + Intergenic
1203667685 Un_KI270754v1:29239-29261 GCTCCTGCTCTGCAAAGCCTCGG + Intergenic
1203667968 Un_KI270754v1:30651-30673 GCTCCTGCTCTGCAAAGCCTCGG + Intergenic
1203668251 Un_KI270754v1:32062-32084 GCTCCTGCTCTGCAAAGCCTCGG + Intergenic
1203668828 Un_KI270754v1:34878-34900 GCTCCTGCTCTGCAAAGCCTCGG + Intergenic
1203669677 Un_KI270754v1:39104-39126 GCTCCTGCTCTGCAAAGCCTCGG + Intergenic
1186933545 X:14421444-14421466 GCTGCTGCTCTGCTAAAGGCAGG - Intergenic
1187040142 X:15585998-15586020 GCTTCAGCTCTGCAAAGTGCTGG - Intronic
1187259402 X:17671286-17671308 GCTGCAGCTCTGCTGAGTGCTGG - Intronic
1187697912 X:21940019-21940041 GCTGCTGTTCAACAAAATGATGG - Intergenic
1189683691 X:43542193-43542215 CCTTGTTCTCTGCAAAGTGAGGG + Intergenic
1193466092 X:81849403-81849425 GTTGCTGCTCAGCAAAGGTAAGG - Intergenic
1193569760 X:83127917-83127939 GCTGCTGCTTTGCACAGGGAGGG - Intergenic
1197471528 X:126869239-126869261 GCTGCTGCTCTGGAAAGCACAGG - Intergenic
1199605393 X:149574107-149574129 GCTTCTGCTCTCCAAAGTTGTGG + Intergenic
1199633728 X:149795261-149795283 GCTTCTGCTCTCCAAAGTTGTGG - Intergenic
1200112935 X:153752091-153752113 GCTGCTGATCTGCCAGGAGATGG - Intergenic