ID: 1164639582

View in Genome Browser
Species Human (GRCh38)
Location 19:29813963-29813985
Sequence GGCTGCTGCTCTGCAAAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 303}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164639582_1164639587 4 Left 1164639582 19:29813963-29813985 CCTCACTTTGCAGAGCAGCAGCC 0: 1
1: 0
2: 1
3: 33
4: 303
Right 1164639587 19:29813990-29814012 TAGTTCATCTGGAAGCGTGAAGG 0: 1
1: 0
2: 0
3: 5
4: 58
1164639582_1164639585 -7 Left 1164639582 19:29813963-29813985 CCTCACTTTGCAGAGCAGCAGCC 0: 1
1: 0
2: 1
3: 33
4: 303
Right 1164639585 19:29813979-29814001 AGCAGCCAGGGTAGTTCATCTGG 0: 1
1: 0
2: 0
3: 8
4: 126
1164639582_1164639588 5 Left 1164639582 19:29813963-29813985 CCTCACTTTGCAGAGCAGCAGCC 0: 1
1: 0
2: 1
3: 33
4: 303
Right 1164639588 19:29813991-29814013 AGTTCATCTGGAAGCGTGAAGGG 0: 1
1: 0
2: 0
3: 5
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164639582 Original CRISPR GGCTGCTGCTCTGCAAAGTG AGG (reversed) Intronic
900266622 1:1760392-1760414 AGGAGCTGCTCTGCAAAGTGTGG - Intronic
900597548 1:3489414-3489436 GGGGGCTCCTCTGCAGAGTGGGG - Intergenic
901415443 1:9113009-9113031 GCCAGGTTCTCTGCAAAGTGTGG + Intronic
902205785 1:14867147-14867169 GGCTGCTCCCCTGCACAGGGAGG - Intronic
902330704 1:15729962-15729984 GGCTGCTGCTCTGCCATCTCAGG - Intronic
903182697 1:21613018-21613040 GGCTCCTCTTCTGCAAATTGTGG + Intronic
903937935 1:26909691-26909713 GGCTTCTGCTCTTGAAAGAGTGG + Intronic
904210835 1:28886107-28886129 GTTTCCTCCTCTGCAAAGTGGGG - Intergenic
904391880 1:30191432-30191454 GGCTGCTGCTCTGATGGGTGTGG - Intergenic
904391888 1:30191474-30191496 GGCTGCTGCTCTGATGGGTGTGG - Intergenic
904391904 1:30191557-30191579 GGCTGCTGCTCTGATGGGTGTGG - Intergenic
905386578 1:37608534-37608556 GGCTCTTGCTCCTCAAAGTGTGG - Intergenic
905596844 1:39214956-39214978 AGCTTCTGCTCTGCAAATGGAGG + Intronic
905852775 1:41286531-41286553 GGCTGCTGGCCTGGACAGTGGGG + Intergenic
906581118 1:46935775-46935797 TGCATCTGCTCTGTAAAGTGAGG - Intronic
907400192 1:54220466-54220488 TACAGCTGATCTGCAAAGTGGGG + Intronic
907511797 1:54967041-54967063 ATCTTCTGGTCTGCAAAGTGTGG + Intergenic
908775087 1:67631950-67631972 GGCTGATGCTGTGCCAGGTGGGG + Intergenic
909094872 1:71274247-71274269 AGCTGCTTCCCTGCCAAGTGTGG - Intergenic
909984709 1:82146679-82146701 GGCTTCTGCACTGCCAGGTGGGG + Intergenic
910951567 1:92653704-92653726 CGCTGCTGCTCTGCATGGAGAGG - Intronic
911360272 1:96867424-96867446 AGCTTCTGTTCTGCAAAATGGGG - Intergenic
911360404 1:96869107-96869129 AGCTTCTGTTCTGCAAAATGGGG - Intergenic
912324701 1:108746712-108746734 GGCTGCTGCTCCGCAGTGTCGGG + Exonic
912519609 1:110236092-110236114 GGCTGATTCACTGAAAAGTGAGG - Intronic
915015556 1:152729955-152729977 CCCTGCTGCTCTGCAGGGTGGGG + Intergenic
915593863 1:156885445-156885467 GTCTCCTCCTCTGCAAAATGAGG + Intergenic
915828602 1:159104298-159104320 GGCTGCTGCTGTGGGCAGTGTGG - Intronic
916492169 1:165311594-165311616 GGCTGTTGGTCTTCAAAGTTTGG - Intronic
917577551 1:176339881-176339903 GTCTGCTGCTTTGCATAATGAGG + Intergenic
918130232 1:181621162-181621184 GGCTGTTGCTATTCAATGTGAGG + Intronic
918329497 1:183444429-183444451 AGCAGCTGCTCTGCAGCGTGGGG + Intergenic
918436123 1:184515025-184515047 GTTTCCTGCTCTGCAAAATGGGG + Intronic
919730598 1:200911636-200911658 TGCTGCTGCCCGGCGAAGTGGGG - Exonic
922080833 1:222294365-222294387 AGCTGCTGCTGTGCAAAGAGTGG - Intergenic
922695809 1:227730373-227730395 GGCAGCCGCTGTGCAGAGTGTGG - Intronic
922717600 1:227885453-227885475 GGCTGCTCACCTGCAAAGGGGGG - Intergenic
922876082 1:228940765-228940787 GGCTGCTGCTGGGCAGGGTGGGG + Intergenic
924727430 1:246683531-246683553 GGCTGCTGCGCTGCCATGAGCGG + Intergenic
1064089791 10:12373725-12373747 GTCTGCCGCTCTGCATGGTGGGG + Intronic
1067280014 10:44864198-44864220 GGCTGCCTCTCTTCAAAGGGCGG + Intergenic
1069597299 10:69680601-69680623 TGTTGCTCATCTGCAAAGTGGGG + Intergenic
1069896665 10:71684352-71684374 GGATGCTGCTCTGCACAAGGAGG + Intronic
1070288641 10:75100687-75100709 GGCAGCTGCTCTGCTGAGCGGGG - Intronic
1070682924 10:78461902-78461924 GCCAGCTACTCTGCAAAGTCTGG + Intergenic
1070809623 10:79291058-79291080 TGCTGCTGCCCCGCAAACTGTGG - Exonic
1070829851 10:79411636-79411658 GCCTCCTCCTCTGGAAAGTGGGG - Intronic
1070953655 10:80450588-80450610 CACTGCTGCTATGAAAAGTGTGG - Intergenic
1072131436 10:92498101-92498123 CCCTGCTCATCTGCAAAGTGGGG - Intronic
1073385602 10:103125520-103125542 GACTGCTAATCTGCAAAATGTGG - Intronic
1074105772 10:110388761-110388783 TCCAGCTGCTCTGGAAAGTGGGG + Intergenic
1074405508 10:113177417-113177439 TGCTGCTGCTCGGACAAGTGGGG + Intergenic
1074410911 10:113227681-113227703 TGCTGATGCTGTGAAAAGTGAGG - Intergenic
1075282067 10:121147725-121147747 GGAAGCTGCTCTGTAAAGAGAGG - Intergenic
1076764560 10:132625809-132625831 GGCTGCTTCTCTGCAAGGGCTGG + Intronic
1077170171 11:1162562-1162584 AGCTGCTGCTCTGCTGAATGAGG - Exonic
1079021081 11:16909525-16909547 GGCTGCTGCCTTGGAGAGTGTGG - Intronic
1079292226 11:19198623-19198645 GGCAGCTTTTCTGCAAAGTGAGG - Intronic
1083332859 11:61907080-61907102 GGTTTCTGCTTTGTAAAGTGGGG + Intronic
1083969833 11:66068168-66068190 GGCTCCTGAGCTGCAAGGTGTGG + Exonic
1084419592 11:69053665-69053687 GGCTCCTCCTCTGTCAAGTGGGG - Intronic
1084674881 11:70628554-70628576 GGCTCCTCCTCTGCAAAATAGGG - Intronic
1085193234 11:74647420-74647442 GGCTTCTTTTCTGCAAAATGTGG - Intronic
1085509588 11:77081551-77081573 GAGTGCTGCTCTGCATGGTGGGG + Intronic
1086771655 11:90774763-90774785 GTCTGCTGCTTTGCAGACTGTGG + Intergenic
1088848053 11:113683959-113683981 GGATGCTGGACTGGAAAGTGGGG + Intergenic
1089277974 11:117352300-117352322 ATCTGCTGCTCTGGAGAGTGGGG + Intronic
1090206643 11:124887831-124887853 TGCTGCAGCTCTGCAAAGAAAGG + Exonic
1091194953 11:133722673-133722695 GTCTTCTGCTCAGTAAAGTGGGG + Intergenic
1100136130 12:91555848-91555870 GCTTGCTGCTCTGCAAAAGGTGG + Intergenic
1101473814 12:105024748-105024770 GGCTGTTACTATTCAAAGTGTGG - Intronic
1102008281 12:109602628-109602650 GTCTGCTTCTCTGCAAAATGGGG - Intergenic
1103232258 12:119341328-119341350 GGCAGCTGCTCTGCAGGGGGAGG + Intronic
1103627671 12:122232826-122232848 GGCTGCCGCTCCTCAAAGTGGGG + Exonic
1103642958 12:122366993-122367015 GACTGCTGCTCTGAATGGTGTGG - Intronic
1104256359 12:127142949-127142971 GTCTGCTGATCTGCAGACTGTGG + Intergenic
1104660692 12:130609753-130609775 GGCTGCAGGTCTGGGAAGTGGGG + Intronic
1105617989 13:22038161-22038183 AACTGCTGCCCTGCAATGTGTGG + Intergenic
1105625397 13:22107571-22107593 GGCTGTTGCTTTGCACAGGGTGG - Intergenic
1105971355 13:25431654-25431676 AGTTGCTTCTCTGTAAAGTGTGG + Intronic
1106548780 13:30753634-30753656 AGCTTCTGCTCTATAAAGTGAGG - Intronic
1106680953 13:32006899-32006921 GCTTGATGCCCTGCAAAGTGTGG - Intergenic
1113547337 13:111164203-111164225 GCCTCCTGATCTGCTAAGTGGGG - Intronic
1113682234 13:112252505-112252527 TGGGTCTGCTCTGCAAAGTGTGG - Intergenic
1114216472 14:20661093-20661115 GGCTGCTGCTTTCTAAAGTAGGG + Intergenic
1115437979 14:33398254-33398276 GACTGGGGCTCTGCACAGTGTGG - Intronic
1116497994 14:45586412-45586434 GGCTGTTTCTCTGCTATGTGTGG + Intergenic
1117099914 14:52335434-52335456 GGGTGCTGCTGTGCAGAGTATGG + Intergenic
1118006614 14:61569143-61569165 GGCTTCTGCTCTGTAAAATGGGG + Intronic
1118475198 14:66109853-66109875 GGTTGCTGCTCTACAACATGGGG + Intergenic
1119656962 14:76424099-76424121 GTTTGCTCCTCTGCAAAATGAGG + Intronic
1119664294 14:76473535-76473557 GGCTAAAGCTCTGCAAAGCGTGG - Intronic
1119736547 14:76986243-76986265 GGCTGCATCCCTGCAAAGTGGGG - Intergenic
1119772017 14:77225946-77225968 GGCTGCTTGCTTGCAAAGTGGGG - Intronic
1121431198 14:93889625-93889647 GTTTCCTGGTCTGCAAAGTGTGG + Intergenic
1121954175 14:98198953-98198975 TGCTGCAGATGTGCAAAGTGAGG + Intergenic
1122094132 14:99358939-99358961 GCCTTCTTCTCTGTAAAGTGAGG - Intergenic
1122117345 14:99534530-99534552 GGCTACTGCTCTGCAGAGCAAGG - Intronic
1122359261 14:101149976-101149998 GCCTCCTGCTCAGCAAGGTGGGG - Intergenic
1122599420 14:102913879-102913901 GGCTGCTGCAGTGCAGAGTCAGG - Intergenic
1124142753 15:27091816-27091838 GGCTGCTGTACTGCATCGTGGGG + Intronic
1125522626 15:40356700-40356722 GGCTTCTGGTCTGTAGAGTGAGG - Intergenic
1126857059 15:52848698-52848720 TCCTGATGCTCTGAAAAGTGAGG + Intergenic
1126997049 15:54456131-54456153 AACTGATGCTCGGCAAAGTGGGG - Intronic
1127626514 15:60785627-60785649 GGCTGCAGCCCTGAAACGTGAGG - Intronic
1127807895 15:62537915-62537937 GGCTGCTGCTCTTAACAGTGTGG - Intronic
1128059958 15:64729140-64729162 AGCTGCTGCTCAGCAAGGTGGGG - Intergenic
1129776156 15:78237750-78237772 GGCTGCTGCTGCCAAAAGTGTGG - Intronic
1130114677 15:80996452-80996474 GGTTGTTGGTCTGTAAAGTGTGG + Intergenic
1130411638 15:83653552-83653574 GGCGCCAGCTCTGCAAAGTCAGG - Intergenic
1130903937 15:88226868-88226890 GTTTGCTGCTCTGTAAAATGGGG - Intronic
1131538156 15:93254445-93254467 TATTGCTGCTTTGCAAAGTGAGG + Intergenic
1131605220 15:93896398-93896420 GGAGGCTGCTCTGCCAAGTCTGG - Intergenic
1131799481 15:96054214-96054236 GGCAGCTGGTCTGCAAGGTGAGG + Intergenic
1132047958 15:98580719-98580741 GGCTTCTGCTCTGCCACGTTGGG - Intergenic
1132781459 16:1628691-1628713 GGCCTCTGCTCTGAGAAGTGCGG + Intronic
1133003735 16:2865657-2865679 GGCTTCAGCCCTGCAAACTGTGG - Intergenic
1137378956 16:47980016-47980038 AGCTGCTGTTCTGCAGAATGTGG - Intergenic
1137861178 16:51848575-51848597 TGCTGCTTCTCACCAAAGTGGGG + Intergenic
1138203028 16:55104233-55104255 GCCTGCTCATCTGTAAAGTGGGG + Intergenic
1138533285 16:57646511-57646533 GGCGGCTGCTCTGGAAGCTGGGG + Intronic
1138549776 16:57741001-57741023 GGCTCCTCGTCTGGAAAGTGGGG - Intronic
1139148184 16:64347529-64347551 GGCTGCTGCACTGGACATTGTGG + Intergenic
1139669848 16:68485261-68485283 GGGTGCTCCTCTGCACTGTGGGG + Intergenic
1141702492 16:85648883-85648905 GTCTCCTTCTCTGCAACGTGAGG + Intronic
1142138618 16:88462733-88462755 GTCTCCATCTCTGCAAAGTGGGG + Intronic
1142432184 16:90035406-90035428 GGCTGCTGCTCTTCAGGCTGTGG + Intronic
1142472861 17:172814-172836 AGCTCCTCCTCTGGAAAGTGGGG - Intronic
1144478244 17:15607804-15607826 GGCTGCTGCTCTGCAGAGAAGGG + Intronic
1144920049 17:18755902-18755924 GGCTGCTGCTCTGCAGAGAAGGG - Intronic
1144947019 17:18974768-18974790 GGCTCCTCATCTGCAAAATGAGG - Intronic
1145058088 17:19716213-19716235 GCCTGCTGCTGAGCAAAGTCAGG + Intronic
1146061375 17:29609180-29609202 GGCTGCTGCTCAGCCCACTGAGG + Exonic
1146487722 17:33257472-33257494 GGCTGTGGCTCAGAAAAGTGAGG + Intronic
1146708663 17:35021483-35021505 GCCTGCTGCTCAGGAAAGTCTGG + Exonic
1147864295 17:43542805-43542827 TGCTGCTTCTCTTCAAATTGGGG + Intronic
1148227294 17:45907851-45907873 GTTTGCTTCTCTGCAAAATGAGG - Intronic
1148336129 17:46842328-46842350 GGCTGCTGCTCTACAACCTCAGG + Intronic
1148809685 17:50282416-50282438 GGCTGCTGCTGAGGGAAGTGAGG + Intergenic
1151386081 17:73756297-73756319 GTCTTCTCCTCTGCAAAATGGGG - Intergenic
1151427589 17:74041079-74041101 GGCTGCTAATCTGTAAAGTGGGG - Intergenic
1151825714 17:76523168-76523190 GGCTGCAGCTCCCGAAAGTGAGG + Intergenic
1152240196 17:79157000-79157022 GGCTGCTGCTCTGGCCAGGGAGG - Intronic
1153142456 18:1989182-1989204 GGACTCTGCTCTGCAATGTGTGG - Intergenic
1153304819 18:3621999-3622021 GGCTGCTGCTTTGCCAACAGAGG + Intronic
1154220827 18:12452319-12452341 ACCTTCTGCTCTGCAAAGAGGGG - Exonic
1154399580 18:14023779-14023801 GGCTGCTACTCTTAGAAGTGAGG + Intergenic
1156160219 18:34350638-34350660 GGCTGCAGCTGTCCAAATTGTGG + Intergenic
1156740137 18:40316011-40316033 GGCTCCTCATCTGCAAAATGGGG + Intergenic
1156946452 18:42838942-42838964 GGAAGTTGCTCTGCAAGGTGAGG - Intronic
1157687177 18:49651770-49651792 GGCTGCTCCTCTGTAAACGGGGG + Intergenic
1157885714 18:51364369-51364391 GGTTGTTGGTTTGCAAAGTGTGG - Intergenic
1159103175 18:63977643-63977665 GGCTGCTGCTATACCAAGGGAGG + Intronic
1159754646 18:72349346-72349368 TGCAGCTGCTGTGCCAAGTGTGG - Intergenic
1160236875 18:77092866-77092888 GCCTGCTGCCCTGCTCAGTGGGG + Intronic
1160706788 19:533624-533646 GGCTGCTGTTCTGGAAGGAGGGG + Intronic
1160752532 19:741302-741324 GGCTGCGGCTCTGCCAGGTGTGG - Intronic
1160781667 19:880211-880233 GCCTCCTGCTCTGCAGGGTGTGG + Intronic
1161537555 19:4829487-4829509 GGCGCCTGCTCTTCAGAGTGAGG - Intronic
1161745717 19:6058500-6058522 GCCTGCTGCTCTGGAATGTGTGG - Intronic
1164389451 19:27805436-27805458 GGAAGCTGCTCAACAAAGTGTGG - Intergenic
1164639582 19:29813963-29813985 GGCTGCTGCTCTGCAAAGTGAGG - Intronic
1165059391 19:33197698-33197720 GCCTGCTGCTCTGCTCGGTGGGG + Intronic
1168692463 19:58385417-58385439 GGCTGCTACTCTGCACAGGATGG + Intergenic
1168713872 19:58516202-58516224 GCCTGCTGCTCCACAGAGTGGGG + Intronic
926386440 2:12340056-12340078 GGTTTCTCCTCTGCAAAATGAGG - Intergenic
927098545 2:19767597-19767619 ACCTGCTGCCCTGCAAAGGGTGG + Intergenic
928986980 2:37191466-37191488 GGCTGCTGCTTTCCATTGTGTGG + Intronic
931128264 2:59302055-59302077 GGCTTCTGCTCTGGGAAGTCTGG + Intergenic
932310524 2:70736010-70736032 GGCTTCTGCGATGGAAAGTGGGG - Intronic
933392145 2:81684542-81684564 GCATGCTGATCTGCAAAGTGAGG - Intergenic
933393668 2:81704771-81704793 GGCTGATGAACTGCAAAATGAGG + Intergenic
934098784 2:88631514-88631536 TGCTGCTGCTAAGCAAAATGAGG + Intergenic
934570990 2:95373222-95373244 GGATGCTGCTCAGCAAGGTGTGG + Intronic
935362421 2:102258212-102258234 GGCAGCTGTTCTGCACATTGTGG - Intergenic
935922002 2:108025804-108025826 GGCTGCTGCTCAGTTGAGTGAGG - Intergenic
935925970 2:108068765-108068787 GGGTTCTCCTCTGCAAAGTGCGG + Intergenic
936028632 2:109053737-109053759 GGCTGCTGCTCTATAAACAGGGG + Intergenic
937096178 2:119236665-119236687 AGCTGCAGATCTGCTAAGTGGGG - Intronic
937523542 2:122739888-122739910 GGCTGCTGCTTAGAAAGGTGGGG + Intergenic
942230969 2:173860679-173860701 CGTTACTGATCTGCAAAGTGGGG - Intergenic
942783465 2:179672949-179672971 CTCTGCTCCTCTGCAAGGTGGGG + Intronic
942972343 2:181971612-181971634 GTCTGGTGCTGTGCTAAGTGTGG - Intronic
943961563 2:194271045-194271067 GGCTGCTGCTCAGCAAGTTTTGG + Intergenic
945090440 2:206172102-206172124 GGCTGCCAGTCTGGAAAGTGAGG - Intergenic
947581404 2:231321401-231321423 GGCTGCTGCTACCCAAAGTGTGG - Intronic
947743640 2:232496673-232496695 GGCTGCAGCTCTGGAAGGTAGGG + Intergenic
948311333 2:236989154-236989176 AGCTGCTTCTCTGCAGACTGAGG - Intergenic
948935724 2:241163172-241163194 GGCTTCAGCTCTGCGATGTGGGG - Intronic
1171283057 20:23917500-23917522 GGCTGCTGCCATGAACAGTGAGG - Intergenic
1171457862 20:25282104-25282126 GGCTGCTGCTGTGCAACCCGGGG + Exonic
1171697699 20:28200906-28200928 AGCTGCTGCTTTGCAAAGAAAGG - Intergenic
1172478385 20:35255767-35255789 GTCTCCTCGTCTGCAAAGTGAGG + Intronic
1172573197 20:35986435-35986457 GCCTCCTGCTCTGTAAAATGGGG + Intronic
1172586828 20:36091560-36091582 GGCTCCTGATCTGCAAAATGGGG + Intronic
1172672931 20:36646698-36646720 TACTGCTGCTATTCAAAGTGTGG - Intergenic
1174076440 20:47940810-47940832 GGTTTCTTCTCTGGAAAGTGAGG + Intergenic
1175226839 20:57449628-57449650 GGCTGCTGCCTTGGAAAGGGAGG - Intergenic
1175259637 20:57666417-57666439 GTCTCCTCATCTGCAAAGTGGGG - Intronic
1175738540 20:61404327-61404349 TGCTGCTTCTCTGGAAAGTTGGG + Intronic
1176213168 20:63935423-63935445 GGCCTCTGCTCTGCAGGGTGGGG + Exonic
1177615357 21:23510245-23510267 GGCTACTGCTAATCAAAGTGTGG - Intergenic
1178499276 21:33112330-33112352 GGCTGCTTCCCTGCAAAATTAGG + Intergenic
1179078107 21:38143039-38143061 GGCTACAGCTCTGAAAAATGTGG - Intronic
1179990093 21:44943515-44943537 GGCTTCTGCTCTGGGAGGTGAGG + Intronic
1180082512 21:45493324-45493346 GGCTGCTGCTGTGACACGTGAGG + Intronic
1181508738 22:23379301-23379323 TGCTGATGCCCTGCACAGTGAGG - Intergenic
1182101264 22:27659169-27659191 ACCTCCTGATCTGCAAAGTGGGG - Intergenic
1182151021 22:28027240-28027262 GGCTGCTGCTCTGCCCTCTGGGG + Intronic
1182248433 22:28979644-28979666 GGTCTCTGCTCTGCTAAGTGAGG - Intronic
1184017240 22:41795455-41795477 GGGTGATGTTCTGCAAGGTGTGG + Exonic
1184017349 22:41795965-41795987 GGGTGATGTTCTGCAAGGTGTGG + Intronic
1184171816 22:42764518-42764540 GGCTGGTGCTCTGTAAAGCTTGG + Intergenic
1185097351 22:48818299-48818321 GGCTTCTGCTGGGCAATGTGAGG - Intronic
950538406 3:13595058-13595080 GTCTGCTGGTCTGCAAAATGGGG + Intronic
950565027 3:13764223-13764245 GTTTTCTGCTCTGTAAAGTGGGG + Intergenic
950672436 3:14535337-14535359 GACTTCTCCTCTGCAAAATGGGG + Intronic
950769079 3:15296642-15296664 GGCTGATGTTCTGCAAAGGTAGG - Intronic
955357929 3:58246915-58246937 GGCTGCTAGGCTGCATAGTGTGG + Intronic
955784310 3:62520739-62520761 AGATGCTGCTTTACAAAGTGAGG + Intronic
955941875 3:64153843-64153865 GGCTGCTGCTTTCCAATGAGTGG + Intronic
961553394 3:127681451-127681473 GGCTTAGGCTCAGCAAAGTGTGG + Intergenic
961903011 3:130232830-130232852 GGCTTCTACTCTCCTAAGTGAGG - Intergenic
961906482 3:130268228-130268250 GTTTTCTGCTCTGCAAAGTGGGG + Intergenic
963564574 3:146912432-146912454 GGCTACTGCTCTCCAGGGTGAGG - Intergenic
964256106 3:154776370-154776392 GGCTGTTGCTCTGCAAGCTGTGG - Intergenic
964725015 3:159805524-159805546 GGTTGCTGATCAGCAAGGTGAGG - Intronic
966071650 3:175885638-175885660 GCCTGCTGCTCTGGCCAGTGGGG + Intergenic
967411848 3:189174183-189174205 GGCTGCTGCTCTGCAAGCTCTGG - Intronic
967805449 3:193711319-193711341 CGCTGCTGCCCACCAAAGTGGGG + Intergenic
968071889 3:195789273-195789295 GGCTGCTGCTGTGTCAGGTGAGG + Exonic
968789327 4:2648654-2648676 GGCTGCAGCTGTGCCATGTGGGG + Intronic
969059440 4:4423415-4423437 GGCTGCTGCTCTACACAGCCAGG - Intronic
969315570 4:6379767-6379789 GGCTCCTCCTCTGTAAAATGAGG + Intronic
969675879 4:8614098-8614120 ATCTGCGGATCTGCAAAGTGGGG + Intronic
969999563 4:11351381-11351403 GGCCACTGCTCTGAGAAGTGGGG - Intergenic
970813818 4:20128918-20128940 GGCTACTGCTCTGAAAGCTGAGG + Intergenic
971558838 4:28047952-28047974 TGCTGCTGCTGTGGAAAGAGGGG + Intergenic
972373669 4:38450071-38450093 CGCTGCAGCTCTGCATAGTTGGG + Intergenic
980110015 4:128626369-128626391 TGCTGCTCCTCTGCCATGTGAGG + Intergenic
980134533 4:128846945-128846967 GGCAGCTGCTCTGCCTACTGCGG + Intronic
983043581 4:162958817-162958839 TACTGCTGCTCTGCAACCTGCGG - Intergenic
985695937 5:1340110-1340132 GGGTGCTGCTTTGCAACATGTGG + Intronic
986605559 5:9520093-9520115 GGCTGCTGCTAGGCCAGGTGAGG - Intronic
986784829 5:11104725-11104747 GGCTGAGGCTGTGCAAAGAGGGG + Intronic
989552602 5:42753358-42753380 GGCCCCTGCTTTTCAAAGTGTGG - Intergenic
990277120 5:54209225-54209247 GGCTTCTGCTTTGGAAATTGAGG - Intronic
990545276 5:56815749-56815771 GGCGGCAGCTGCGCAAAGTGCGG + Exonic
993115949 5:83721127-83721149 GGCTGCTGCTTTACAAGGTCTGG - Exonic
994640541 5:102403112-102403134 AGTTGCTGCTCTGCTGAGTGTGG + Intronic
995324052 5:110872089-110872111 GGCAGCTGTGCTGCAAGGTGGGG - Intergenic
996618497 5:125470740-125470762 TGCTGCCACTCTGCACAGTGGGG + Intergenic
997028278 5:130092131-130092153 GTCTGCTGCAGTGCATAGTGGGG - Intronic
998003102 5:138640006-138640028 GGCTGCTCCTTGGCAAGGTGCGG - Intronic
998319182 5:141213499-141213521 GTTTGCTCCTCTGTAAAGTGAGG - Intergenic
998386555 5:141760480-141760502 GGATGCTCCCCTGCAGAGTGGGG + Intergenic
999296626 5:150463603-150463625 GGCTGCTGCTGTGCAGAGAGGGG + Intergenic
1000685802 5:164247815-164247837 GTCTCCTCATCTGCAAAGTGGGG - Intergenic
1001583540 5:172817118-172817140 CTCTGCTCATCTGCAAAGTGGGG + Intergenic
1001646499 5:173285953-173285975 GGCTGAAGCAGTGCAAAGTGAGG + Intergenic
1001647197 5:173290731-173290753 CGCTGCAGCTCTGCACAGAGAGG + Intergenic
1003776654 6:9373817-9373839 GTCTGCTGCTCTGCCATGTGAGG + Intergenic
1004056996 6:12149323-12149345 GGCTACTGTTCTGCAAACTCTGG - Intronic
1006189925 6:32201423-32201445 GGCTGCAACACTGCAGAGTGTGG - Exonic
1006715526 6:36117057-36117079 GGCTGCTGCTGGCCAAATTGGGG + Intergenic
1006914136 6:37583788-37583810 GGCTGCTGTTCTAGAAAGGGTGG - Intergenic
1007589321 6:43011963-43011985 GGCTGCTGCTCACCAAAGACAGG - Exonic
1011704305 6:89985638-89985660 GGCTGTTTCCCTGCAAAATGGGG + Intronic
1012245897 6:96925083-96925105 GGCTGCTGGTGCGCCAAGTGGGG + Intronic
1012404146 6:98875550-98875572 CGGTGCTGCTCTGCAGAGTTGGG + Exonic
1013971503 6:116025231-116025253 AGCTGGTCCTCTGCAATGTGTGG - Intronic
1016422833 6:143902567-143902589 TGCTGCTGCTCTGCAGGGAGGGG + Intronic
1016656982 6:146530177-146530199 GGTTGCAGCTCTGCAAAGATTGG - Intergenic
1016756188 6:147689982-147690004 GGCTGAGGATCTGCACAGTGGGG + Intronic
1017847887 6:158275293-158275315 GGCTGCTGCTGTCGAAACTGTGG + Intronic
1018002014 6:159587707-159587729 GGCTACTGCTGTGCTCAGTGCGG - Intergenic
1018004520 6:159609174-159609196 TGCTGCTGGTCTGAAAAGTTAGG - Intergenic
1018248853 6:161847922-161847944 GGCTGGTGCTCTGCACACAGGGG + Intronic
1019334756 7:477869-477891 GGCTGCACGTCTGCAGAGTGAGG + Intergenic
1019528907 7:1494063-1494085 GGCTCCTGTCCTGCAAAGGGAGG - Intronic
1019630181 7:2044931-2044953 TGCTGCTGCTCATCAGAGTGGGG - Intronic
1022233604 7:28439548-28439570 GGTTCCTCCTCTGCAAACTGGGG - Intronic
1022662277 7:32378238-32378260 GGCTGCTGCTGTGAGGAGTGTGG - Intergenic
1022808423 7:33846040-33846062 GGCTTCTGCTCTGCAACGATTGG - Intergenic
1024573627 7:50746704-50746726 GGATGCTGCACTGAAAAGGGTGG - Intronic
1024597938 7:50955694-50955716 TGCTCCTGCTCTGCCATGTGAGG - Intergenic
1024907950 7:54410097-54410119 GGATGCTGTCCTGCAAACTGTGG - Intergenic
1026769496 7:73185988-73186010 GGCTGATGATCTACAGAGTGTGG - Intergenic
1027010365 7:74739374-74739396 GGCTGATGATCTACAGAGTGTGG - Intronic
1027077677 7:75206670-75206692 GGCTGATGATCTACAGAGTGTGG + Intergenic
1027887492 7:83927943-83927965 GTTTGCTGATCTGCAAAGTATGG + Intergenic
1029088721 7:98031779-98031801 GGCTACTCAGCTGCAAAGTGAGG - Intergenic
1029587057 7:101481151-101481173 GTCTGCTGATCAGCAGAGTGAGG - Intronic
1030973456 7:116090577-116090599 GGCAACTGCTCTCCAAAATGAGG + Intronic
1033473132 7:141666832-141666854 GGCTGCTACTGTGCAAAGTGAGG + Intronic
1034720591 7:153289229-153289251 CCCTGCTGCTCTTCATAGTGTGG - Intergenic
1034911775 7:155003288-155003310 GGCCGCCGCTCTGCAACGAGGGG + Intergenic
1035025153 7:155820262-155820284 GCCTCCTCCTCTGGAAAGTGGGG - Intergenic
1035246059 7:157562563-157562585 GGCTGCTGGCCTTCAAAGTCCGG + Intronic
1035551883 8:534702-534724 GTTTGCTGCTCTGCAAGTTGTGG + Intronic
1037894319 8:22641720-22641742 GGTGGGTGCTCTGCAAAGTTAGG - Intronic
1038018749 8:23535589-23535611 GGTTCCTTCTCTGCAAAGTGGGG + Intronic
1039548252 8:38425026-38425048 GACTCCTGCTATTCAAAGTGTGG + Intronic
1039778819 8:40763381-40763403 GTTTGCTTCTCTGCTAAGTGGGG + Intronic
1040568934 8:48591435-48591457 AGCTGCTGCTCTGCAGAGTTGGG + Intergenic
1041957642 8:63573793-63573815 GTTTCCTCCTCTGCAAAGTGGGG - Intergenic
1045679066 8:104639566-104639588 GGCTGCTGTTCTGGGAAGTGTGG + Intronic
1047197658 8:122736055-122736077 GTTTTCTCCTCTGCAAAGTGAGG - Intergenic
1047767966 8:128004710-128004732 GGCTGCACAGCTGCAAAGTGAGG - Intergenic
1049383075 8:142327032-142327054 GGCAGCTGCTTTGGAAAGTCTGG + Intronic
1050628755 9:7536686-7536708 GGCTCCTGCTGTGCAAAGGAAGG - Intergenic
1052916148 9:33925610-33925632 GGCTGCTGGTTTGCACAGTGGGG + Intronic
1052967136 9:34348635-34348657 GGCTTCTCCTCTCCAAACTGTGG - Intergenic
1053303346 9:36967006-36967028 GTCTTCTCATCTGCAAAGTGGGG - Intronic
1054870488 9:70044026-70044048 GGGAGCCGCTCTGCAAAGTTGGG + Exonic
1056821116 9:89842760-89842782 CGCTGCAGCTCTGCAAGGTGTGG + Intergenic
1057860506 9:98637067-98637089 GGTTGCAGCTCTTCAAAGTTGGG - Intronic
1058063223 9:100521617-100521639 AGCTGCTTCTCTGGATAGTGGGG + Intronic
1058198052 9:102002951-102002973 GCCTGGTGCTCTGTAAATTGTGG - Intergenic
1059112706 9:111571860-111571882 GGGTGCTGGTTTTCAAAGTGTGG - Intronic
1059751429 9:117251103-117251125 AGCTTCTCCTCTGCAAAGCGAGG - Intronic
1060519110 9:124283857-124283879 GCCCGCTGCTCTGCAAAGCAGGG - Intronic
1060767973 9:126309050-126309072 GCCTGCTGGTCTGCAAAGGAGGG - Intergenic
1060809898 9:126605729-126605751 GTCTGCTTATCTGGAAAGTGGGG - Intergenic
1060887179 9:127162711-127162733 GAGTGGTGCTCTGCAAACTGAGG - Intronic
1061757998 9:132828602-132828624 GGCTGCAGCTCTGGCAGGTGGGG + Intronic
1062290597 9:135792644-135792666 GGCTGCTGTTCTGCACTCTGGGG + Exonic
1062294425 9:135816549-135816571 GGCTGCTGCTCTCACAAGGGAGG + Intronic
1062434555 9:136541122-136541144 GGCAGCTGCTGTGCGAGGTGTGG - Intronic
1062464935 9:136676760-136676782 GCCAGCTGCTTTGCGAAGTGGGG - Intronic
1185970976 X:4663262-4663284 TGCTGTTGCTAGGCAAAGTGGGG - Intergenic
1186821093 X:13288704-13288726 GGCTTCTGCTCCTCAAAGTGGGG + Intergenic
1190327867 X:49217892-49217914 GGGTGCAGCTCTTCAAGGTGGGG - Exonic
1193073545 X:77332336-77332358 GGCAGATGCACTGCACAGTGGGG + Intergenic
1193569761 X:83127918-83127940 GGCTGCTGCTTTGCACAGGGAGG - Intergenic
1197224556 X:123944125-123944147 GGTTTCTTCTCTGAAAAGTGAGG + Intergenic
1197721457 X:129747492-129747514 GGCAGCTGGGCTGCAAAGGGAGG + Intronic
1199434004 X:147792750-147792772 GCCTGCTGCTTTTGAAAGTGAGG + Intergenic