ID: 1164639587

View in Genome Browser
Species Human (GRCh38)
Location 19:29813990-29814012
Sequence TAGTTCATCTGGAAGCGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 58}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164639579_1164639587 27 Left 1164639579 19:29813940-29813962 CCAGCTAGGTTAGCAGAGAAGCC 0: 1
1: 0
2: 0
3: 9
4: 91
Right 1164639587 19:29813990-29814012 TAGTTCATCTGGAAGCGTGAAGG 0: 1
1: 0
2: 0
3: 5
4: 58
1164639578_1164639587 28 Left 1164639578 19:29813939-29813961 CCCAGCTAGGTTAGCAGAGAAGC 0: 1
1: 0
2: 1
3: 10
4: 114
Right 1164639587 19:29813990-29814012 TAGTTCATCTGGAAGCGTGAAGG 0: 1
1: 0
2: 0
3: 5
4: 58
1164639580_1164639587 6 Left 1164639580 19:29813961-29813983 CCCCTCACTTTGCAGAGCAGCAG 0: 1
1: 1
2: 1
3: 39
4: 289
Right 1164639587 19:29813990-29814012 TAGTTCATCTGGAAGCGTGAAGG 0: 1
1: 0
2: 0
3: 5
4: 58
1164639582_1164639587 4 Left 1164639582 19:29813963-29813985 CCTCACTTTGCAGAGCAGCAGCC 0: 1
1: 0
2: 1
3: 33
4: 303
Right 1164639587 19:29813990-29814012 TAGTTCATCTGGAAGCGTGAAGG 0: 1
1: 0
2: 0
3: 5
4: 58
1164639581_1164639587 5 Left 1164639581 19:29813962-29813984 CCCTCACTTTGCAGAGCAGCAGC 0: 1
1: 0
2: 1
3: 31
4: 305
Right 1164639587 19:29813990-29814012 TAGTTCATCTGGAAGCGTGAAGG 0: 1
1: 0
2: 0
3: 5
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164639587 Original CRISPR TAGTTCATCTGGAAGCGTGA AGG Intronic
909017600 1:70396594-70396616 TAGTTCATCTGGAAAGGGGAAGG + Intergenic
913245470 1:116866607-116866629 TAGTTCCTTTGCAAGAGTGAGGG - Intergenic
916952695 1:169796729-169796751 TAGATCACCTGGAACCTTGAAGG - Intronic
922430176 1:225543979-225544001 TCGTGCATTTGGAAGCGTGATGG - Intronic
922708572 1:227807525-227807547 TAATTCATGTGGAAGAGTAATGG - Intergenic
1064516564 10:16155544-16155566 TAGGTCATCAGGAAGCCTGGGGG + Intergenic
1067360628 10:45574878-45574900 TAGTCCTTTTGGAAGAGTGAGGG - Intronic
1072222884 10:93341659-93341681 TAGTTCATGTGGAAAGGTTATGG + Intronic
1076077446 10:127546201-127546223 TAGGTCATCTGGAAGCTGGTAGG + Intergenic
1078354775 11:10625477-10625499 AAGTCCATCTGCAAGTGTGAAGG - Intronic
1081684527 11:45032898-45032920 TAGTTGATCTGGAAGGATAAGGG - Intergenic
1087885165 11:103472111-103472133 TAGTTCATATGGAAGAATGGTGG + Intronic
1088435987 11:109813611-109813633 TAGATCATCTGGAAAGATGAAGG - Intergenic
1091176177 11:133560028-133560050 TAGTTCATATGGAATCATAATGG + Intergenic
1094400990 12:30060314-30060336 TAGTTCTTTTGCAAGAGTGAGGG - Intergenic
1101348827 12:103909025-103909047 TAGGCCATCTGGTAGGGTGAGGG - Intergenic
1101456457 12:104836644-104836666 GAGTCCATCTGGAAACCTGAAGG + Intronic
1108089185 13:46828981-46829003 TTGTTCTTCAGGAAGCCTGAGGG + Intergenic
1122507957 14:102243956-102243978 TAGTTCCTTTGCAAGAGTGAGGG - Intronic
1124871284 15:33545528-33545550 TATTTTATAAGGAAGCGTGAAGG + Intronic
1128242879 15:66113396-66113418 GATTTCACCTGGAAGCTTGAGGG + Intronic
1128602050 15:69003774-69003796 TTGTCCATCTAGAAGAGTGAAGG + Intronic
1130984492 15:88836185-88836207 TAGTTCACCTGGAAGAGGGGAGG - Exonic
1133224311 16:4333340-4333362 GAGTTCAGCAGGAAGCCTGAGGG - Exonic
1139754026 16:69128523-69128545 TAGTTCATTTAGCTGCGTGAAGG - Intronic
1141143852 16:81515343-81515365 TTTTCCATCTAGAAGCGTGAGGG - Intronic
1164639587 19:29813990-29814012 TAGTTCATCTGGAAGCGTGAAGG + Intronic
1165106605 19:33473594-33473616 AAGTACCTCTGGAAGCGTCAGGG - Intronic
1167769790 19:51507998-51508020 GAGTTCACCAGGAAGCATGAAGG + Intergenic
925121990 2:1426725-1426747 TAGATCATCAGGAAACATGATGG + Intronic
927055512 2:19362275-19362297 TAGTTCCTCTGGAACCATTACGG + Intergenic
929383886 2:41382438-41382460 TAGTCCATTTGCAAGAGTGAGGG - Intergenic
931978089 2:67665489-67665511 TGGTTCATCTGGAGATGTGAAGG - Intergenic
941275334 2:163483914-163483936 TAGTTCATCTGCAAGGCTCATGG + Intergenic
944867210 2:203874394-203874416 TAGTTCATTTGGAAGCCACAGGG - Intergenic
946270797 2:218591780-218591802 TACTTCATCTGGAAGAGAGGAGG + Intronic
948758637 2:240175323-240175345 TGATTCATTTGGAAGCGTAAAGG - Intergenic
1172385327 20:34530120-34530142 GAGTTCATGTGGAAGCCTGGGGG - Intronic
1173652383 20:44674864-44674886 TAGTTCCTTTGCAAGAGTGAGGG - Intergenic
1174522440 20:51142075-51142097 CAGTTCATCTGGGACCGAGAGGG + Intergenic
1178679729 21:34663713-34663735 TTTTTCATCTGGAACAGTGAGGG - Intergenic
955817525 3:62861139-62861161 TAGGTCAGCTGGAAGCCAGATGG + Intronic
957904520 3:86539589-86539611 TAGTTCATTTGCAAGAGTGAGGG + Intergenic
965742964 3:171896008-171896030 CAGTTCATCTGGAAGCTGGGCGG + Intronic
971997414 4:33982902-33982924 AAGGTCATCTGGAAGCATCAAGG - Intergenic
973665845 4:53158473-53158495 TTGGTCAACTGGAAGAGTGATGG - Intronic
974382806 4:61163023-61163045 TATTTCCTTTGGAAGTGTGAGGG + Intergenic
974794301 4:66729052-66729074 CAGTTCATCTGGTAGCTTGCAGG + Intergenic
993774856 5:91980671-91980693 TAGTTGATCTGGCAGCATTAGGG - Intergenic
996595295 5:125194708-125194730 TAGTTCACCTGAGAGTGTGAGGG - Intergenic
1000142111 5:158415464-158415486 TAGTTCTTCTGAAAGGTTGATGG + Intergenic
1012952198 6:105530178-105530200 CAGTTCATCTGGAAGCCAGAGGG + Intergenic
1026626400 7:71996235-71996257 TATTTCATCTGGTAGCTTCATGG - Intronic
1030778760 7:113570964-113570986 TAATTCATATGGAAATGTGATGG + Intergenic
1031138093 7:117908050-117908072 GAGTTTATCTGGAGGAGTGAGGG - Intergenic
1037849437 8:22314615-22314637 CTGTTCATTTGGAAGCATGAGGG - Intronic
1045663662 8:104464417-104464439 TGCTTCATCTGGAACCCTGATGG + Intronic
1051411878 9:16798077-16798099 TTGTTGATCTGGAAGTGTGAAGG + Intronic
1051898412 9:22012392-22012414 TAGGTGAGCTGGAAGAGTGAAGG - Intronic
1052517564 9:29502978-29503000 TCGTTAATCTGGAAATGTGAAGG + Intergenic
1052730863 9:32283630-32283652 ATGTTCATCTGCAAGTGTGATGG - Intergenic
1062146869 9:134994435-134994457 GAGTTCATCTCGCAGGGTGATGG - Intergenic
1189482191 X:41400587-41400609 TATATCATGTGGAAGCATGAGGG - Intergenic
1191825892 X:65364235-65364257 TAGTTCCTTTGCAAGAGTGAGGG - Intergenic