ID: 1164640529

View in Genome Browser
Species Human (GRCh38)
Location 19:29822033-29822055
Sequence CTGCATGTATACATTCAGCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 1, 2: 1, 3: 9, 4: 142}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164640529 Original CRISPR CTGCATGTATACATTCAGCC AGG (reversed) Exonic
900859555 1:5218325-5218347 CTGCATGTTTAACTTCATCCTGG - Intergenic
904160100 1:28516909-28516931 CTGCATATAAGAATTCAGCCTGG + Intronic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
911779480 1:101858312-101858334 CTGCATTTATGCATTCAGGAAGG + Intronic
920955589 1:210617885-210617907 CTTCATGTATTCATTCAGCTTGG + Intronic
921228953 1:213049720-213049742 CTCCATATATACATTCACCATGG + Intergenic
921457042 1:215384143-215384165 CTACATGCATACAATCTGCCTGG + Intergenic
923109245 1:230877851-230877873 CTGAATGTTTACATTTAGACAGG + Intergenic
923817166 1:237393638-237393660 CTGCATATATCTTTTCAGCCTGG + Intronic
1062785002 10:257140-257162 CTGCATATTTCCATTCAGACTGG + Intergenic
1063571415 10:7217483-7217505 GCGCATGTATATATTTAGCCAGG + Intronic
1065621017 10:27581220-27581242 TTTAATGTATGCATTCAGCCTGG - Intergenic
1071511940 10:86267567-86267589 CTGCATGCATCTATCCAGCCTGG - Intronic
1072502321 10:96030205-96030227 CCAAATTTATACATTCAGCCAGG + Intronic
1073378149 10:103054752-103054774 CTGCATGTGTACAGTAGGCCAGG + Intronic
1074229390 10:111518420-111518442 TTTCAGGTATACATTCAGCAAGG - Intergenic
1075778842 10:125004240-125004262 CTGCATCTAGACGTTCAGCAGGG + Intronic
1077937603 11:6804867-6804889 CTCCATCTCTGCATTCAGCCTGG + Intergenic
1078405771 11:11068669-11068691 GTGTATGTACACATTCAGCCAGG + Intergenic
1078943817 11:16040390-16040412 CTTAATGATTACATTCAGCCAGG + Intronic
1080899252 11:36472312-36472334 ATGCATGCATGGATTCAGCCCGG - Intergenic
1081207168 11:40289926-40289948 TTGCATGTATACATTAAGTGTGG + Intronic
1084962414 11:72724130-72724152 GTGCATTTACACATTCAGACAGG - Intronic
1090793111 11:130109504-130109526 ATGCATGTGAACATTCAGACTGG + Exonic
1091832873 12:3562811-3562833 CTGCCTGTATACATTCCCTCAGG + Intronic
1093179660 12:15952775-15952797 GCGCATGTCTACACTCAGCCTGG + Intronic
1097609736 12:61805663-61805685 CTGCAGGTATATATTCATTCTGG - Intronic
1097891953 12:64785731-64785753 TTACATGTATGCATTCAGCTCGG - Intronic
1098263205 12:68692617-68692639 CTGCATTTCTGCATTTAGCCTGG - Intronic
1099068426 12:78013755-78013777 CTTCATCTATACATTTAACCTGG - Intronic
1099754074 12:86818625-86818647 CCACATGTATACATTCAACAGGG + Intronic
1103051057 12:117779918-117779940 ATGCATGCACACATTCTGCCTGG - Intronic
1103653387 12:122451176-122451198 CCATATATATACATTCAGCCAGG + Intergenic
1107402144 13:40079977-40079999 CTGCATGTTTTCATTCAGCCAGG - Intergenic
1107671871 13:42754299-42754321 CTGTATGTGTCCCTTCAGCCAGG - Intergenic
1108128777 13:47274346-47274368 CTGAATGAAGGCATTCAGCCAGG + Intergenic
1111244741 13:85521555-85521577 ATGCAGGTATATATTCATCCAGG - Intergenic
1121086008 14:91146569-91146591 CTGCAGGTGTACATTCCTCCGGG - Intronic
1122138148 14:99646237-99646259 CTCCATTTCTGCATTCAGCCAGG - Intronic
1123627763 15:22239262-22239284 CAGCATGGATTCCTTCAGCCTGG - Intergenic
1124596782 15:31097820-31097842 CAGCATGTCTCCATTCACCCTGG - Intronic
1125587445 15:40830875-40830897 ATGCATGTAAACATTTAGCATGG + Intergenic
1126012554 15:44316976-44316998 TTGAATATATATATTCAGCCTGG - Intronic
1126596616 15:50389832-50389854 GAACATGTCTACATTCAGCCCGG - Intergenic
1128683560 15:69668000-69668022 CTGCATGTCAACATGGAGCCAGG - Intergenic
1128890534 15:71327896-71327918 CAGAATGTATTAATTCAGCCGGG + Intronic
1129625132 15:77189332-77189354 GTGCATGCATGCATTCATCCTGG - Intronic
1135829512 16:25761034-25761056 CTCCATGCATGCATTCACCCTGG - Intronic
1136342381 16:29653172-29653194 CTTCATGTATCCATTTTGCCTGG - Intergenic
1137450025 16:48563782-48563804 ATGAATATATACAATCAGCCAGG - Intronic
1137771471 16:51019236-51019258 CTGAATGGAAACAGTCAGCCTGG + Intergenic
1139820493 16:69717319-69717341 CTGCAGGAACACATTCAGCAGGG + Intronic
1140124479 16:72108291-72108313 CTGCAGGTAAACATTCAGGTAGG - Exonic
1141311738 16:82920143-82920165 CTGAATTTATACACCCAGCCAGG - Intronic
1141753545 16:85975828-85975850 CTGCAGGTCTGCATTCACCCAGG - Intergenic
1141976194 16:87518090-87518112 CAGCATGGATTCCTTCAGCCTGG + Intergenic
1142224660 16:88871668-88871690 CTGCCTGGATAAATTCTGCCAGG - Intergenic
1142703335 17:1677982-1678004 TTTCATGTATACATTTAGACAGG - Intronic
1145186031 17:20795017-20795039 ATGCTTGTATACTTCCAGCCTGG - Intergenic
1150164101 17:62924963-62924985 ATTCATTTATCCATTCAGCCAGG - Intergenic
1150647085 17:66985625-66985647 CTGCATGTGTGCATTCAGGAAGG - Intronic
1151691969 17:75692125-75692147 CTGCAGCTATTCATTCAACCTGG - Intronic
1151853926 17:76708713-76708735 CTGCCTGCAAACATTAAGCCAGG - Intronic
1158261434 18:55610260-55610282 CTGCATGAAAACATTAGGCCAGG - Intronic
1161908166 19:7173078-7173100 TTTCATGAATATATTCAGCCTGG - Intronic
1164640529 19:29822033-29822055 CTGCATGTATACATTCAGCCAGG - Exonic
1165162018 19:33822014-33822036 CTGAGTGTCTACAATCAGCCTGG + Intergenic
928953334 2:36834730-36834752 CTGTCTGTATACAGTCAGCTTGG + Intergenic
930439604 2:51390036-51390058 CAGCATGTTTAGATCCAGCCAGG - Intergenic
933400376 2:81788858-81788880 CTACATGAAGACATTCAGCAAGG - Intergenic
937409949 2:121665725-121665747 CAGCATGTCTGCTTTCAGCCTGG - Intergenic
939014911 2:136891606-136891628 CTCCCTGTGTCCATTCAGCCAGG + Intronic
940368778 2:152877622-152877644 CTGCATGTATACAGACATACAGG + Intergenic
940824284 2:158393189-158393211 TTTCATGTATACATCCATCCTGG - Intronic
944856578 2:203773858-203773880 CTGCATGAGTACTTTCACCCTGG - Intergenic
946338244 2:219052594-219052616 CTCCATGTAGACATTCTACCTGG - Intergenic
946577719 2:221094444-221094466 CAGCATGTATCCATTCAACTTGG + Intergenic
1171030123 20:21669500-21669522 CAGCACCTACACATTCAGCCAGG - Intergenic
1174186681 20:48711187-48711209 ATGCATGTATCCACTCAGCCAGG + Intronic
1178595792 21:33951280-33951302 CTGCCTGTTTACATGCGGCCTGG + Intergenic
1184476423 22:44724550-44724572 GTGCCTGTGTACTTTCAGCCTGG + Intronic
949921273 3:9004020-9004042 CTGCATGAATAAGTTCAGCAAGG + Intronic
950739746 3:15040821-15040843 CAGAATTTATACATCCAGCCAGG + Intronic
959263883 3:104113891-104113913 CTGGATGGATCCTTTCAGCCAGG + Intergenic
959696436 3:109253691-109253713 TTGCATGACTACACTCAGCCTGG + Intergenic
961170321 3:124793246-124793268 CTGCGTGTGTCCATGCAGCCTGG - Intronic
961637345 3:128341840-128341862 CAGCTTGTACACCTTCAGCCTGG - Exonic
962706989 3:138053108-138053130 CTGCATCTTTACATCCAGCAGGG + Intergenic
962993738 3:140604731-140604753 CAGAATGTATCCACTCAGCCTGG - Intergenic
964201050 3:154120066-154120088 CTGCATTCATGCATTCAGCAGGG - Intergenic
964391415 3:156201703-156201725 CTGCATGCATACACTCATGCTGG + Intronic
965614136 3:170575897-170575919 GTGGATGTATTTATTCAGCCAGG - Intronic
967244533 3:187471936-187471958 CTGCATGTACACATCCAGATGGG - Intergenic
967357665 3:188590753-188590775 CTGCATTCCTACATGCAGCCTGG - Intronic
970243735 4:14036293-14036315 CTGCATGTATAAAATAATCCAGG - Intergenic
970683430 4:18537004-18537026 CTGCATGTAAACAGTCAGTTTGG + Intergenic
970798203 4:19940378-19940400 CAGTATGTCTACATTTAGCCTGG + Intergenic
970835254 4:20397067-20397089 CTTCATGCATACATCAAGCCAGG - Intronic
971903655 4:32697333-32697355 CTGCTTGTATTCATTCATCTGGG - Intergenic
973611209 4:52637386-52637408 TTGCCAGTATTCATTCAGCCTGG - Intronic
973998870 4:56489710-56489732 ATGCATGTACACATACAGCAAGG - Intronic
976969404 4:91086518-91086540 CAGCATTTATACATTTAGCAGGG - Intronic
980756324 4:137167934-137167956 CTGCGTGTATACATACACACAGG - Intergenic
980756326 4:137167973-137167995 CTGCGTGTATACATACACACAGG - Intergenic
982230777 4:153206462-153206484 TTGAATGAATACATACAGCCAGG + Intronic
982589883 4:157294799-157294821 CTGCAGACATTCATTCAGCCTGG + Intronic
984029706 4:174587444-174587466 CTGAAACTACACATTCAGCCTGG - Intergenic
985696529 5:1344172-1344194 TGGCCTGTAAACATTCAGCCTGG - Intronic
987372427 5:17205469-17205491 CTGCATCTATTCATTTAGCCAGG + Intronic
989335578 5:40312815-40312837 CTGAATGTATAGTTTCTGCCTGG + Intergenic
990447070 5:55903302-55903324 CTGCATGAAGACAGTCACCCGGG - Intronic
992382926 5:76256222-76256244 CTGCATTCTTAAATTCAGCCTGG - Intronic
994215356 5:97131487-97131509 CTGACTGGATACATTTAGCCAGG - Intronic
997287594 5:132692660-132692682 TTGTATGTATACATGCAGCATGG - Exonic
999293438 5:150442741-150442763 TTGCATCACTACATTCAGCCTGG - Intergenic
999369028 5:151041813-151041835 CTTCATTTATCCATTCATCCCGG - Intronic
999798938 5:155014975-155014997 CTGCATTTATAGATCCAGGCAGG - Exonic
1001102761 5:168827749-168827771 CTTCATGTATTCATCCCGCCTGG - Intronic
1002090194 5:176800411-176800433 GTGCGTGTATGCATTCAGTCTGG + Intergenic
1003036049 6:2641051-2641073 CTGCATGGTTACATTTACCCTGG - Intergenic
1003248899 6:4407058-4407080 CTGCATGTCTTCTTTCAGCAAGG - Intergenic
1004070607 6:12293746-12293768 CTGCCTGGATACATACAGTCAGG + Intronic
1006037562 6:31225422-31225444 CTGCATGTATGCATTCAGCCAGG - Intergenic
1010424340 6:75709943-75709965 CAGCATGTATACATTTATCCTGG - Intronic
1011047425 6:83100764-83100786 CTGGATGTAGACATTGAGCTAGG - Exonic
1012828450 6:104177268-104177290 GTGCATGTATACATTAAGTTTGG - Intergenic
1015214976 6:130739709-130739731 CTGAATGAATACCTTGAGCCTGG + Intergenic
1020138349 7:5598894-5598916 CTGCATGTCTACCTACAGGCAGG - Intronic
1021424402 7:20483299-20483321 CTCCATTGATACATACAGCCTGG + Intergenic
1025568948 7:62531355-62531377 CTGCATGTATTCATTTAGTGCGG + Intergenic
1028312654 7:89358378-89358400 ATGCAGGTATACATTCACTCTGG + Intergenic
1029982311 7:104890483-104890505 CTGCATGTAAACAGTAAGCTAGG - Intronic
1032063911 7:128749923-128749945 CTGCATTTCTATTTTCAGCCTGG - Intronic
1032859764 7:135865894-135865916 CTGGATGAATTCATTCAGCCAGG - Intergenic
1035076660 7:156182263-156182285 CTGCAGGTATACATTATGCTTGG + Intergenic
1037670336 8:21010175-21010197 CTGCATGAAGACAGTCAGCCTGG + Intergenic
1040023817 8:42763777-42763799 GTGCATGCACACTTTCAGCCTGG + Intronic
1041657902 8:60372579-60372601 CTGCATATATACTTTCAGGTTGG + Intergenic
1045332667 8:101169147-101169169 CTGAATGAATGTATTCAGCCTGG - Intergenic
1045722871 8:105134096-105134118 CCACATGTTTAGATTCAGCCAGG - Intronic
1047346280 8:124031811-124031833 TTTCATGTGTACTTTCAGCCTGG - Intronic
1050120058 9:2298903-2298925 GTGCATGTCTGCGTTCAGCCTGG + Intergenic
1051965974 9:22830557-22830579 CTGGATGAATACATTCATCCTGG + Intergenic
1056735121 9:89202987-89203009 CTCCATGTATACAGCCAGCTTGG + Intergenic
1059593334 9:115688791-115688813 ATGAATATATACATTCAGCCTGG + Intergenic
1185990352 X:4888269-4888291 TTGCATGTTTACACTCACCCTGG - Intergenic
1186754018 X:12650888-12650910 CAGCAAGTTGACATTCAGCCTGG + Intronic
1187329279 X:18321429-18321451 ATGCATGCATACATTAAGACAGG + Intronic
1187544846 X:20239550-20239572 TTGCATATATACAATCTGCCAGG - Intronic
1196556578 X:117091602-117091624 CACCATGTATATATTCAGCGTGG - Intergenic
1196605961 X:117657331-117657353 CTGCATGTATAGATTCCATCTGG - Intergenic
1196913777 X:120511452-120511474 CCTCATGTATACATCCAACCAGG - Intergenic
1197632139 X:128873599-128873621 ATGTATGCATACATCCAGCCTGG + Intergenic
1200748230 Y:6921540-6921562 CTGCATGTTTCCCTTGAGCCTGG + Intronic