ID: 1164644009

View in Genome Browser
Species Human (GRCh38)
Location 19:29844932-29844954
Sequence GCCCGCACTGCGGGAGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164644000_1164644009 4 Left 1164644000 19:29844905-29844927 CCTGGCAATGCACAGGGGCTCTT No data
Right 1164644009 19:29844932-29844954 GCCCGCACTGCGGGAGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164644009 Original CRISPR GCCCGCACTGCGGGAGGGGC AGG Intergenic
No off target data available for this crispr