ID: 1164648101 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 19:29873618-29873640 |
| Sequence | GCGCGGGGCCGGGTCGGAGC GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1164648101_1164648115 | 18 | Left | 1164648101 | 19:29873618-29873640 | CCCGCTCCGACCCGGCCCCGCGC | No data | ||
| Right | 1164648115 | 19:29873659-29873681 | GCAAAGCGTCTGCTGCCATCTGG | 0: 1 1: 0 2: 0 3: 7 4: 100 |
||||
| 1164648101_1164648117 | 24 | Left | 1164648101 | 19:29873618-29873640 | CCCGCTCCGACCCGGCCCCGCGC | No data | ||
| Right | 1164648117 | 19:29873665-29873687 | CGTCTGCTGCCATCTGGTGGCGG | 0: 1 1: 1 2: 1 3: 24 4: 173 |
||||
| 1164648101_1164648116 | 21 | Left | 1164648101 | 19:29873618-29873640 | CCCGCTCCGACCCGGCCCCGCGC | No data | ||
| Right | 1164648116 | 19:29873662-29873684 | AAGCGTCTGCTGCCATCTGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1164648101 | Original CRISPR | GCGCGGGGCCGGGTCGGAGC GGG (reversed) | Intergenic | ||