ID: 1164648101

View in Genome Browser
Species Human (GRCh38)
Location 19:29873618-29873640
Sequence GCGCGGGGCCGGGTCGGAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164648101_1164648115 18 Left 1164648101 19:29873618-29873640 CCCGCTCCGACCCGGCCCCGCGC No data
Right 1164648115 19:29873659-29873681 GCAAAGCGTCTGCTGCCATCTGG No data
1164648101_1164648116 21 Left 1164648101 19:29873618-29873640 CCCGCTCCGACCCGGCCCCGCGC No data
Right 1164648116 19:29873662-29873684 AAGCGTCTGCTGCCATCTGGTGG No data
1164648101_1164648117 24 Left 1164648101 19:29873618-29873640 CCCGCTCCGACCCGGCCCCGCGC No data
Right 1164648117 19:29873665-29873687 CGTCTGCTGCCATCTGGTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164648101 Original CRISPR GCGCGGGGCCGGGTCGGAGC GGG (reversed) Intergenic