ID: 1164648115

View in Genome Browser
Species Human (GRCh38)
Location 19:29873659-29873681
Sequence GCAAAGCGTCTGCTGCCATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164648111_1164648115 -5 Left 1164648111 19:29873641-29873663 CCTCCCGGCCGCTCGATCGCAAA No data
Right 1164648115 19:29873659-29873681 GCAAAGCGTCTGCTGCCATCTGG No data
1164648113_1164648115 -9 Left 1164648113 19:29873645-29873667 CCGGCCGCTCGATCGCAAAGCGT No data
Right 1164648115 19:29873659-29873681 GCAAAGCGTCTGCTGCCATCTGG No data
1164648107_1164648115 3 Left 1164648107 19:29873633-29873655 CCCCGCGCCCTCCCGGCCGCTCG No data
Right 1164648115 19:29873659-29873681 GCAAAGCGTCTGCTGCCATCTGG No data
1164648102_1164648115 17 Left 1164648102 19:29873619-29873641 CCGCTCCGACCCGGCCCCGCGCC No data
Right 1164648115 19:29873659-29873681 GCAAAGCGTCTGCTGCCATCTGG No data
1164648112_1164648115 -8 Left 1164648112 19:29873644-29873666 CCCGGCCGCTCGATCGCAAAGCG No data
Right 1164648115 19:29873659-29873681 GCAAAGCGTCTGCTGCCATCTGG No data
1164648098_1164648115 25 Left 1164648098 19:29873611-29873633 CCCTGACCCCGCTCCGACCCGGC No data
Right 1164648115 19:29873659-29873681 GCAAAGCGTCTGCTGCCATCTGG No data
1164648108_1164648115 2 Left 1164648108 19:29873634-29873656 CCCGCGCCCTCCCGGCCGCTCGA No data
Right 1164648115 19:29873659-29873681 GCAAAGCGTCTGCTGCCATCTGG No data
1164648096_1164648115 26 Left 1164648096 19:29873610-29873632 CCCCTGACCCCGCTCCGACCCGG No data
Right 1164648115 19:29873659-29873681 GCAAAGCGTCTGCTGCCATCTGG No data
1164648101_1164648115 18 Left 1164648101 19:29873618-29873640 CCCGCTCCGACCCGGCCCCGCGC No data
Right 1164648115 19:29873659-29873681 GCAAAGCGTCTGCTGCCATCTGG No data
1164648100_1164648115 19 Left 1164648100 19:29873617-29873639 CCCCGCTCCGACCCGGCCCCGCG No data
Right 1164648115 19:29873659-29873681 GCAAAGCGTCTGCTGCCATCTGG No data
1164648105_1164648115 8 Left 1164648105 19:29873628-29873650 CCCGGCCCCGCGCCCTCCCGGCC No data
Right 1164648115 19:29873659-29873681 GCAAAGCGTCTGCTGCCATCTGG No data
1164648109_1164648115 1 Left 1164648109 19:29873635-29873657 CCGCGCCCTCCCGGCCGCTCGAT No data
Right 1164648115 19:29873659-29873681 GCAAAGCGTCTGCTGCCATCTGG No data
1164648106_1164648115 7 Left 1164648106 19:29873629-29873651 CCGGCCCCGCGCCCTCCCGGCCG No data
Right 1164648115 19:29873659-29873681 GCAAAGCGTCTGCTGCCATCTGG No data
1164648103_1164648115 12 Left 1164648103 19:29873624-29873646 CCGACCCGGCCCCGCGCCCTCCC No data
Right 1164648115 19:29873659-29873681 GCAAAGCGTCTGCTGCCATCTGG No data
1164648110_1164648115 -4 Left 1164648110 19:29873640-29873662 CCCTCCCGGCCGCTCGATCGCAA No data
Right 1164648115 19:29873659-29873681 GCAAAGCGTCTGCTGCCATCTGG No data
1164648099_1164648115 24 Left 1164648099 19:29873612-29873634 CCTGACCCCGCTCCGACCCGGCC No data
Right 1164648115 19:29873659-29873681 GCAAAGCGTCTGCTGCCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164648115 Original CRISPR GCAAAGCGTCTGCTGCCATC TGG Intergenic