ID: 1164648132 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 19:29873737-29873759 |
| Sequence | GGCGCGGGGGCGCTGGGTGG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1164648132_1164648147 | 2 | Left | 1164648132 | 19:29873737-29873759 | CCCCCACCCAGCGCCCCCGCGCC | No data | ||
| Right | 1164648147 | 19:29873762-29873784 | CGCGCCCGCGCCGCTCTCCCGGG | No data | ||||
| 1164648132_1164648153 | 22 | Left | 1164648132 | 19:29873737-29873759 | CCCCCACCCAGCGCCCCCGCGCC | No data | ||
| Right | 1164648153 | 19:29873782-29873804 | GGGAAGTCCCCAACAGCCTCTGG | No data | ||||
| 1164648132_1164648146 | 1 | Left | 1164648132 | 19:29873737-29873759 | CCCCCACCCAGCGCCCCCGCGCC | No data | ||
| Right | 1164648146 | 19:29873761-29873783 | CCGCGCCCGCGCCGCTCTCCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1164648132 | Original CRISPR | GGCGCGGGGGCGCTGGGTGG GGG (reversed) | Intergenic | ||