ID: 1164648137

View in Genome Browser
Species Human (GRCh38)
Location 19:29873744-29873766
Sequence GCGCGGGGGCGCGGGGGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164648137_1164648147 -5 Left 1164648137 19:29873744-29873766 CCAGCGCCCCCGCGCCCCCGCGC No data
Right 1164648147 19:29873762-29873784 CGCGCCCGCGCCGCTCTCCCGGG No data
1164648137_1164648153 15 Left 1164648137 19:29873744-29873766 CCAGCGCCCCCGCGCCCCCGCGC No data
Right 1164648153 19:29873782-29873804 GGGAAGTCCCCAACAGCCTCTGG No data
1164648137_1164648146 -6 Left 1164648137 19:29873744-29873766 CCAGCGCCCCCGCGCCCCCGCGC No data
Right 1164648146 19:29873761-29873783 CCGCGCCCGCGCCGCTCTCCCGG No data
1164648137_1164648157 25 Left 1164648137 19:29873744-29873766 CCAGCGCCCCCGCGCCCCCGCGC No data
Right 1164648157 19:29873792-29873814 CAACAGCCTCTGGCTTTGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164648137 Original CRISPR GCGCGGGGGCGCGGGGGCGC TGG (reversed) Intergenic