ID: 1164648140

View in Genome Browser
Species Human (GRCh38)
Location 19:29873752-29873774
Sequence CGGCGCGGGCGCGGGGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164648140_1164648153 7 Left 1164648140 19:29873752-29873774 CCCGCGCCCCCGCGCCCGCGCCG No data
Right 1164648153 19:29873782-29873804 GGGAAGTCCCCAACAGCCTCTGG No data
1164648140_1164648157 17 Left 1164648140 19:29873752-29873774 CCCGCGCCCCCGCGCCCGCGCCG No data
Right 1164648157 19:29873792-29873814 CAACAGCCTCTGGCTTTGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164648140 Original CRISPR CGGCGCGGGCGCGGGGGCGC GGG (reversed) Intergenic
No off target data available for this crispr