ID: 1164648140 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 19:29873752-29873774 |
| Sequence | CGGCGCGGGCGCGGGGGCGC GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1164648140_1164648153 | 7 | Left | 1164648140 | 19:29873752-29873774 | CCCGCGCCCCCGCGCCCGCGCCG | No data | ||
| Right | 1164648153 | 19:29873782-29873804 | GGGAAGTCCCCAACAGCCTCTGG | No data | ||||
| 1164648140_1164648157 | 17 | Left | 1164648140 | 19:29873752-29873774 | CCCGCGCCCCCGCGCCCGCGCCG | No data | ||
| Right | 1164648157 | 19:29873792-29873814 | CAACAGCCTCTGGCTTTGCTCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1164648140 | Original CRISPR | CGGCGCGGGCGCGGGGGCGC GGG (reversed) | Intergenic | ||