ID: 1164648146

View in Genome Browser
Species Human (GRCh38)
Location 19:29873761-29873783
Sequence CCGCGCCCGCGCCGCTCTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164648137_1164648146 -6 Left 1164648137 19:29873744-29873766 CCAGCGCCCCCGCGCCCCCGCGC No data
Right 1164648146 19:29873761-29873783 CCGCGCCCGCGCCGCTCTCCCGG No data
1164648132_1164648146 1 Left 1164648132 19:29873737-29873759 CCCCCACCCAGCGCCCCCGCGCC No data
Right 1164648146 19:29873761-29873783 CCGCGCCCGCGCCGCTCTCCCGG No data
1164648131_1164648146 18 Left 1164648131 19:29873720-29873742 CCAGGCTGGTGCTCAGACCCCCA No data
Right 1164648146 19:29873761-29873783 CCGCGCCCGCGCCGCTCTCCCGG No data
1164648133_1164648146 0 Left 1164648133 19:29873738-29873760 CCCCACCCAGCGCCCCCGCGCCC No data
Right 1164648146 19:29873761-29873783 CCGCGCCCGCGCCGCTCTCCCGG No data
1164648135_1164648146 -2 Left 1164648135 19:29873740-29873762 CCACCCAGCGCCCCCGCGCCCCC No data
Right 1164648146 19:29873761-29873783 CCGCGCCCGCGCCGCTCTCCCGG No data
1164648134_1164648146 -1 Left 1164648134 19:29873739-29873761 CCCACCCAGCGCCCCCGCGCCCC No data
Right 1164648146 19:29873761-29873783 CCGCGCCCGCGCCGCTCTCCCGG No data
1164648136_1164648146 -5 Left 1164648136 19:29873743-29873765 CCCAGCGCCCCCGCGCCCCCGCG No data
Right 1164648146 19:29873761-29873783 CCGCGCCCGCGCCGCTCTCCCGG No data
1164648130_1164648146 23 Left 1164648130 19:29873715-29873737 CCTGGCCAGGCTGGTGCTCAGAC No data
Right 1164648146 19:29873761-29873783 CCGCGCCCGCGCCGCTCTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164648146 Original CRISPR CCGCGCCCGCGCCGCTCTCC CGG Intergenic